FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628408_at:

>probe:Drosophila_2:1628408_at:421:533; Interrogation_Position=1020; Antisense; GGTGTAATCTTAGGCACTCAGACTA
>probe:Drosophila_2:1628408_at:253:73; Interrogation_Position=1101; Antisense; AGGCACTTGATGTCTCTCCGCGATT
>probe:Drosophila_2:1628408_at:33:465; Interrogation_Position=1122; Antisense; GATTGCGTTGCGTTGTCGGATCACA
>probe:Drosophila_2:1628408_at:395:171; Interrogation_Position=1210; Antisense; AAAGTTCAGCTTATTGGGATCCAAT
>probe:Drosophila_2:1628408_at:647:3; Interrogation_Position=1222; Antisense; ATTGGGATCCAATTGTTCCGTCTGC
>probe:Drosophila_2:1628408_at:509:469; Interrogation_Position=1236; Antisense; GTTCCGTCTGCTGATTTATACTTGA
>probe:Drosophila_2:1628408_at:441:3; Interrogation_Position=735; Antisense; ATTGACGAAGCCCTTATCGACTTGG
>probe:Drosophila_2:1628408_at:163:297; Interrogation_Position=752; Antisense; CGACTTGGCCACATATCATATTCAG
>probe:Drosophila_2:1628408_at:203:467; Interrogation_Position=791; Antisense; GTTGGCCATAGCATCTAGTCCAGTG
>probe:Drosophila_2:1628408_at:678:677; Interrogation_Position=806; Antisense; TAGTCCAGTGGCAAGTTATTCATTA
>probe:Drosophila_2:1628408_at:661:237; Interrogation_Position=844; Antisense; AATCGGACTGGACACATTGGCAGCT
>probe:Drosophila_2:1628408_at:343:151; Interrogation_Position=857; Antisense; ACATTGGCAGCTCTTCCTACAGGAA
>probe:Drosophila_2:1628408_at:639:383; Interrogation_Position=897; Antisense; GAACTGGCATCTCTAATGTCTATTA
>probe:Drosophila_2:1628408_at:174:459; Interrogation_Position=945; Antisense; GATATCTCAGAAGTATGCCATGGCA

Paste this into a BLAST search page for me
GGTGTAATCTTAGGCACTCAGACTAAGGCACTTGATGTCTCTCCGCGATTGATTGCGTTGCGTTGTCGGATCACAAAAGTTCAGCTTATTGGGATCCAATATTGGGATCCAATTGTTCCGTCTGCGTTCCGTCTGCTGATTTATACTTGAATTGACGAAGCCCTTATCGACTTGGCGACTTGGCCACATATCATATTCAGGTTGGCCATAGCATCTAGTCCAGTGTAGTCCAGTGGCAAGTTATTCATTAAATCGGACTGGACACATTGGCAGCTACATTGGCAGCTCTTCCTACAGGAAGAACTGGCATCTCTAATGTCTATTAGATATCTCAGAAGTATGCCATGGCA

Full Affymetrix probeset data:

Annotations for 1628408_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720