Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628409_at:

>probe:Drosophila_2:1628409_at:246:21; Interrogation_Position=1104; Antisense; ATATTCCGGCGTACTGCACTACGAA
>probe:Drosophila_2:1628409_at:441:603; Interrogation_Position=1132; Antisense; TGTTGCATGCAACGTGAGTCCGATT
>probe:Drosophila_2:1628409_at:149:469; Interrogation_Position=1157; Antisense; GTTGCCCGTTCGTATTACTTACAGA
>probe:Drosophila_2:1628409_at:650:141; Interrogation_Position=1173; Antisense; ACTTACAGAGAACTGCGGGTCCCTT
>probe:Drosophila_2:1628409_at:598:529; Interrogation_Position=1189; Antisense; GGGTCCCTTTCTGGCAATATAGTTC
>probe:Drosophila_2:1628409_at:398:213; Interrogation_Position=1245; Antisense; AAGAGATATTCCTCCAGCCTTTTTA
>probe:Drosophila_2:1628409_at:453:99; Interrogation_Position=1291; Antisense; AGATGGGTCTCTCGATAGCTATCGC
>probe:Drosophila_2:1628409_at:232:25; Interrogation_Position=1305; Antisense; ATAGCTATCGCACCCCGTTATCGAT
>probe:Drosophila_2:1628409_at:356:137; Interrogation_Position=1332; Antisense; ACGAGCACTACGGTTGCGTTTGTAC
>probe:Drosophila_2:1628409_at:259:327; Interrogation_Position=1347; Antisense; GCGTTTGTACAAATCGATTTCCGAA
>probe:Drosophila_2:1628409_at:544:105; Interrogation_Position=1381; Antisense; AGACACACTGCACCTATCGATATAT
>probe:Drosophila_2:1628409_at:657:407; Interrogation_Position=1515; Antisense; GACGGCAACCGAACTACAGTATAAT
>probe:Drosophila_2:1628409_at:672:723; Interrogation_Position=1607; Antisense; TTGTAAACCCATTTAAGCCCATGTA
>probe:Drosophila_2:1628409_at:258:125; Interrogation_Position=1622; Antisense; AGCCCATGTAAAAATCCGCCTTCAT

Paste this into a BLAST search page for me
ATATTCCGGCGTACTGCACTACGAATGTTGCATGCAACGTGAGTCCGATTGTTGCCCGTTCGTATTACTTACAGAACTTACAGAGAACTGCGGGTCCCTTGGGTCCCTTTCTGGCAATATAGTTCAAGAGATATTCCTCCAGCCTTTTTAAGATGGGTCTCTCGATAGCTATCGCATAGCTATCGCACCCCGTTATCGATACGAGCACTACGGTTGCGTTTGTACGCGTTTGTACAAATCGATTTCCGAAAGACACACTGCACCTATCGATATATGACGGCAACCGAACTACAGTATAATTTGTAAACCCATTTAAGCCCATGTAAGCCCATGTAAAAATCCGCCTTCAT

Full Affymetrix probeset data:

Annotations for 1628409_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime