FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628411_at:

>probe:Drosophila_2:1628411_at:95:635; Interrogation_Position=3543; Antisense; TCGACCCTACGATTGTAATCTCTGC
>probe:Drosophila_2:1628411_at:630:37; Interrogation_Position=3560; Antisense; ATCTCTGCCCGGAGAAATTCTTCTT
>probe:Drosophila_2:1628411_at:571:245; Interrogation_Position=3575; Antisense; AATTCTTCTTTCGAGCTGAGTTGGA
>probe:Drosophila_2:1628411_at:469:647; Interrogation_Position=3615; Antisense; TCATGAGCTGAGACCGCAGGCCCGA
>probe:Drosophila_2:1628411_at:414:539; Interrogation_Position=3660; Antisense; GGTACCATCCATACGGAACACTTCA
>probe:Drosophila_2:1628411_at:494:309; Interrogation_Position=3689; Antisense; GCCAGAGTCCGGTAAGAAGTCCCAC
>probe:Drosophila_2:1628411_at:713:209; Interrogation_Position=3702; Antisense; AAGAAGTCCCACCATTGTCAAACAG
>probe:Drosophila_2:1628411_at:554:197; Interrogation_Position=3738; Antisense; AACGGATACCGTCGAGTCAGCCGGA
>probe:Drosophila_2:1628411_at:432:165; Interrogation_Position=3818; Antisense; AAATGCCGCATGAGACACGTCCAAG
>probe:Drosophila_2:1628411_at:405:137; Interrogation_Position=3834; Antisense; ACGTCCAAGTGGGATTGGGTCGCAA
>probe:Drosophila_2:1628411_at:159:561; Interrogation_Position=3861; Antisense; GGAAAGGTCCACCAGCAGCGCCTAA
>probe:Drosophila_2:1628411_at:88:103; Interrogation_Position=3935; Antisense; AGACTTTCGTAGTAGGCTGCCTAGT
>probe:Drosophila_2:1628411_at:689:159; Interrogation_Position=3992; Antisense; ACAATGTCCCCGAAATTTCAGAATT
>probe:Drosophila_2:1628411_at:548:77; Interrogation_Position=4079; Antisense; AGGTCTTGCCACTTATAACGTTGTA

Paste this into a BLAST search page for me
TCGACCCTACGATTGTAATCTCTGCATCTCTGCCCGGAGAAATTCTTCTTAATTCTTCTTTCGAGCTGAGTTGGATCATGAGCTGAGACCGCAGGCCCGAGGTACCATCCATACGGAACACTTCAGCCAGAGTCCGGTAAGAAGTCCCACAAGAAGTCCCACCATTGTCAAACAGAACGGATACCGTCGAGTCAGCCGGAAAATGCCGCATGAGACACGTCCAAGACGTCCAAGTGGGATTGGGTCGCAAGGAAAGGTCCACCAGCAGCGCCTAAAGACTTTCGTAGTAGGCTGCCTAGTACAATGTCCCCGAAATTTCAGAATTAGGTCTTGCCACTTATAACGTTGTA

Full Affymetrix probeset data:

Annotations for 1628411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720