Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628412_at:

>probe:Drosophila_2:1628412_at:418:685; Interrogation_Position=5799; Antisense; TATACAAATGGAGTTACGCCGGCAT
>probe:Drosophila_2:1628412_at:303:473; Interrogation_Position=5811; Antisense; GTTACGCCGGCATATGTTTCAAAGT
>probe:Drosophila_2:1628412_at:102:549; Interrogation_Position=5862; Antisense; GGAGAACGACACTGAAGCTACTTAG
>probe:Drosophila_2:1628412_at:153:705; Interrogation_Position=5930; Antisense; TTATCTCAGCACAATTCTAGTCGTT
>probe:Drosophila_2:1628412_at:638:107; Interrogation_Position=5962; Antisense; AGAACTGTCGTTTATATGTGTGCGT
>probe:Drosophila_2:1628412_at:509:61; Interrogation_Position=5977; Antisense; ATGTGTGCGTTTCAAATCTGTTTAG
>probe:Drosophila_2:1628412_at:301:459; Interrogation_Position=6007; Antisense; GATATTTGGATCTTCCCACAAAAGC
>probe:Drosophila_2:1628412_at:233:175; Interrogation_Position=6027; Antisense; AAAGCCAACCATACGAAATGCCAAT
>probe:Drosophila_2:1628412_at:334:395; Interrogation_Position=6041; Antisense; GAAATGCCAATGAACCTACTAGCTT
>probe:Drosophila_2:1628412_at:380:129; Interrogation_Position=6054; Antisense; ACCTACTAGCTTCGTTCAATTCAAC
>probe:Drosophila_2:1628412_at:328:655; Interrogation_Position=6081; Antisense; TAATGTGTACCAACTAGTTTTCTAG
>probe:Drosophila_2:1628412_at:302:601; Interrogation_Position=6158; Antisense; TGTACAAACCGTTTCTTTTGATCAA
>probe:Drosophila_2:1628412_at:72:483; Interrogation_Position=6299; Antisense; GTATTACTATACAGCCAGCACTTAT
>probe:Drosophila_2:1628412_at:675:125; Interrogation_Position=6311; Antisense; AGCCAGCACTTATTTAGCACTTTAA

Paste this into a BLAST search page for me
TATACAAATGGAGTTACGCCGGCATGTTACGCCGGCATATGTTTCAAAGTGGAGAACGACACTGAAGCTACTTAGTTATCTCAGCACAATTCTAGTCGTTAGAACTGTCGTTTATATGTGTGCGTATGTGTGCGTTTCAAATCTGTTTAGGATATTTGGATCTTCCCACAAAAGCAAAGCCAACCATACGAAATGCCAATGAAATGCCAATGAACCTACTAGCTTACCTACTAGCTTCGTTCAATTCAACTAATGTGTACCAACTAGTTTTCTAGTGTACAAACCGTTTCTTTTGATCAAGTATTACTATACAGCCAGCACTTATAGCCAGCACTTATTTAGCACTTTAA

Full Affymetrix probeset data:

Annotations for 1628412_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime