FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628414_at:

>probe:Drosophila_2:1628414_at:18:287; Interrogation_Position=1219; Antisense; CTGGTGGACCTGAAGAACGCCGATC
>probe:Drosophila_2:1628414_at:161:201; Interrogation_Position=1234; Antisense; AACGCCGATCGCAACATTCAGGTGG
>probe:Drosophila_2:1628414_at:20:329; Interrogation_Position=1291; Antisense; GCGTTTGCCATATCGCAGGTGACCA
>probe:Drosophila_2:1628414_at:92:591; Interrogation_Position=1323; Antisense; TGGTTCCTGCTGTCATTCACGGGAT
>probe:Drosophila_2:1628414_at:78:521; Interrogation_Position=1373; Antisense; GTGGCATTGGCTTCTTTCACAGATC
>probe:Drosophila_2:1628414_at:412:415; Interrogation_Position=1410; Antisense; GACCAAGAGCTGTGCATCCAAAACC
>probe:Drosophila_2:1628414_at:269:175; Interrogation_Position=1430; Antisense; AAACCAAGACCTGTGCTCATAAGCC
>probe:Drosophila_2:1628414_at:123:111; Interrogation_Position=1463; Antisense; AGAAGGCAGCCACTTGTGGACCCAG
>probe:Drosophila_2:1628414_at:662:555; Interrogation_Position=1534; Antisense; GGACGGGCAATTTTCTTGAGCTCGA
>probe:Drosophila_2:1628414_at:384:409; Interrogation_Position=1559; Antisense; GACGATATGCTATTCCGACTGAGAT
>probe:Drosophila_2:1628414_at:712:129; Interrogation_Position=1597; Antisense; ACCATTGTGCTCTGGATGCGCGACA
>probe:Drosophila_2:1628414_at:211:399; Interrogation_Position=1618; Antisense; GACACACTGGTTCGCATGTTGCAGT
>probe:Drosophila_2:1628414_at:286:325; Interrogation_Position=1699; Antisense; GCGAAACTATACGTATTGCCTGGAA
>probe:Drosophila_2:1628414_at:52:137; Interrogation_Position=1726; Antisense; ACGAACCATTCGATCATTTGCAAAA

Paste this into a BLAST search page for me
CTGGTGGACCTGAAGAACGCCGATCAACGCCGATCGCAACATTCAGGTGGGCGTTTGCCATATCGCAGGTGACCATGGTTCCTGCTGTCATTCACGGGATGTGGCATTGGCTTCTTTCACAGATCGACCAAGAGCTGTGCATCCAAAACCAAACCAAGACCTGTGCTCATAAGCCAGAAGGCAGCCACTTGTGGACCCAGGGACGGGCAATTTTCTTGAGCTCGAGACGATATGCTATTCCGACTGAGATACCATTGTGCTCTGGATGCGCGACAGACACACTGGTTCGCATGTTGCAGTGCGAAACTATACGTATTGCCTGGAAACGAACCATTCGATCATTTGCAAAA

Full Affymetrix probeset data:

Annotations for 1628414_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720