FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628417_at:

>probe:Drosophila_2:1628417_at:204:169; Interrogation_Position=109; Antisense; AAAGCTTGGAGGAGGCTACGCCCCT
>probe:Drosophila_2:1628417_at:257:671; Interrogation_Position=125; Antisense; TACGCCCCTGTCTACAACAACTTTG
>probe:Drosophila_2:1628417_at:669:157; Interrogation_Position=138; Antisense; ACAACAACTTTGTCCCATATCCAGT
>probe:Drosophila_2:1628417_at:199:203; Interrogation_Position=186; Antisense; AACCTGTTCCAGTTCCCGTGGCTAT
>probe:Drosophila_2:1628417_at:578:583; Interrogation_Position=204; Antisense; TGGCTATTCCTCAACCAATTCCAGT
>probe:Drosophila_2:1628417_at:347:293; Interrogation_Position=237; Antisense; CCCAACCAGTAGTTATTCCCATCAA
>probe:Drosophila_2:1628417_at:596:485; Interrogation_Position=245; Antisense; GTAGTTATTCCCATCAAACACGGAT
>probe:Drosophila_2:1628417_at:306:479; Interrogation_Position=318; Antisense; GTTTCGGAGGCTACCAGAACTTTGC
>probe:Drosophila_2:1628417_at:132:629; Interrogation_Position=350; Antisense; TCCTCTTTTAGCTCTGCCAGTTCAT
>probe:Drosophila_2:1628417_at:14:283; Interrogation_Position=363; Antisense; CTGCCAGTTCATTTGGCGGTGGCTA
>probe:Drosophila_2:1628417_at:627:573; Interrogation_Position=414; Antisense; GGCGGCGCTGAGAGTATTGTTCTAT
>probe:Drosophila_2:1628417_at:289:95; Interrogation_Position=42; Antisense; AGATAACGATTTTGGGTCTGTCCCT
>probe:Drosophila_2:1628417_at:632:621; Interrogation_Position=66; Antisense; TGCTGCTTTGTTTGGCGCTTGCACA
>probe:Drosophila_2:1628417_at:474:343; Interrogation_Position=82; Antisense; GCTTGCACACTCACATGGTTTTGGT

Paste this into a BLAST search page for me
AAAGCTTGGAGGAGGCTACGCCCCTTACGCCCCTGTCTACAACAACTTTGACAACAACTTTGTCCCATATCCAGTAACCTGTTCCAGTTCCCGTGGCTATTGGCTATTCCTCAACCAATTCCAGTCCCAACCAGTAGTTATTCCCATCAAGTAGTTATTCCCATCAAACACGGATGTTTCGGAGGCTACCAGAACTTTGCTCCTCTTTTAGCTCTGCCAGTTCATCTGCCAGTTCATTTGGCGGTGGCTAGGCGGCGCTGAGAGTATTGTTCTATAGATAACGATTTTGGGTCTGTCCCTTGCTGCTTTGTTTGGCGCTTGCACAGCTTGCACACTCACATGGTTTTGGT

Full Affymetrix probeset data:

Annotations for 1628417_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720