FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628418_at:

>probe:Drosophila_2:1628418_at:373:605; Interrogation_Position=1243; Antisense; TGATCGATCGCTGCAATTCGGTGAT
>probe:Drosophila_2:1628418_at:590:7; Interrogation_Position=1276; Antisense; ATTGCCCATGCATTTTTTCCTAAGG
>probe:Drosophila_2:1628418_at:561:71; Interrogation_Position=1298; Antisense; AGGCATACCTTTGCGGATTCCAATG
>probe:Drosophila_2:1628418_at:3:465; Interrogation_Position=1313; Antisense; GATTCCAATGAATCGGTCTCCGTCG
>probe:Drosophila_2:1628418_at:648:25; Interrogation_Position=1429; Antisense; ATACGACAGTCGGTACGTGTCTCCT
>probe:Drosophila_2:1628418_at:391:45; Interrogation_Position=1467; Antisense; ATCGCTGCTGCAACGATCCTATTGT
>probe:Drosophila_2:1628418_at:351:47; Interrogation_Position=1482; Antisense; ATCCTATTGTGTTTCTTGACCGTGC
>probe:Drosophila_2:1628418_at:87:413; Interrogation_Position=1499; Antisense; GACCGTGCCACGGATTCAATCAAGT
>probe:Drosophila_2:1628418_at:340:653; Interrogation_Position=1518; Antisense; TCAAGTTTAGACTGCACGCTACGGC
>probe:Drosophila_2:1628418_at:46:321; Interrogation_Position=1541; Antisense; GCCCGCCGGCATTTAAATCCTTTGG
>probe:Drosophila_2:1628418_at:234:47; Interrogation_Position=1557; Antisense; ATCCTTTGGCGCCACGGGAATTGTG
>probe:Drosophila_2:1628418_at:106:411; Interrogation_Position=1604; Antisense; GACCCACTAGTGCTCAGTATCCAGA
>probe:Drosophila_2:1628418_at:552:53; Interrogation_Position=1630; Antisense; ATGCATGAACAGCTACGTCTACCAC
>probe:Drosophila_2:1628418_at:673:137; Interrogation_Position=1644; Antisense; ACGTCTACCACGTGCACTTGTATAA

Paste this into a BLAST search page for me
TGATCGATCGCTGCAATTCGGTGATATTGCCCATGCATTTTTTCCTAAGGAGGCATACCTTTGCGGATTCCAATGGATTCCAATGAATCGGTCTCCGTCGATACGACAGTCGGTACGTGTCTCCTATCGCTGCTGCAACGATCCTATTGTATCCTATTGTGTTTCTTGACCGTGCGACCGTGCCACGGATTCAATCAAGTTCAAGTTTAGACTGCACGCTACGGCGCCCGCCGGCATTTAAATCCTTTGGATCCTTTGGCGCCACGGGAATTGTGGACCCACTAGTGCTCAGTATCCAGAATGCATGAACAGCTACGTCTACCACACGTCTACCACGTGCACTTGTATAA

Full Affymetrix probeset data:

Annotations for 1628418_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720