FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628421_at:

>probe:Drosophila_2:1628421_at:323:627; Interrogation_Position=106; Antisense; TCCTTAGGAAAACTCAATGATCTCA
>probe:Drosophila_2:1628421_at:356:231; Interrogation_Position=121; Antisense; AATGATCTCAATGAACTTTTTCTTG
>probe:Drosophila_2:1628421_at:516:469; Interrogation_Position=16; Antisense; GTTCGAATCGGCAGGAATTGAAGCA
>probe:Drosophila_2:1628421_at:391:687; Interrogation_Position=188; Antisense; TATTGTAGCAGCAACAAGGGCAACA
>probe:Drosophila_2:1628421_at:39:253; Interrogation_Position=208; Antisense; CAACAGCAAACGCAACCGCTAAAAA
>probe:Drosophila_2:1628421_at:519:17; Interrogation_Position=267; Antisense; ATTTCAAGTGCAGGACACTCTCGCG
>probe:Drosophila_2:1628421_at:567:643; Interrogation_Position=285; Antisense; TCTCGCGCGTCTTTCACGATGATAA
>probe:Drosophila_2:1628421_at:348:5; Interrogation_Position=32; Antisense; ATTGAAGCAGGCGATGTATTTCGAG
>probe:Drosophila_2:1628421_at:437:303; Interrogation_Position=325; Antisense; CCTTAGGGAGACACGGAAAACACAG
>probe:Drosophila_2:1628421_at:236:401; Interrogation_Position=355; Antisense; GACAGAGTCAACATGTAGAGCTTAA
>probe:Drosophila_2:1628421_at:403:419; Interrogation_Position=372; Antisense; GAGCTTAAGTTTAGAACCCCAGAGA
>probe:Drosophila_2:1628421_at:685:421; Interrogation_Position=393; Antisense; GAGAAGGCGTTTCCCAAACTGAATC
>probe:Drosophila_2:1628421_at:716:235; Interrogation_Position=414; Antisense; AATCGACTAGATCATGTGCAATACG
>probe:Drosophila_2:1628421_at:157:269; Interrogation_Position=72; Antisense; CAGGCGCCGCTGTATGTTGCATGAT

Paste this into a BLAST search page for me
TCCTTAGGAAAACTCAATGATCTCAAATGATCTCAATGAACTTTTTCTTGGTTCGAATCGGCAGGAATTGAAGCATATTGTAGCAGCAACAAGGGCAACACAACAGCAAACGCAACCGCTAAAAAATTTCAAGTGCAGGACACTCTCGCGTCTCGCGCGTCTTTCACGATGATAAATTGAAGCAGGCGATGTATTTCGAGCCTTAGGGAGACACGGAAAACACAGGACAGAGTCAACATGTAGAGCTTAAGAGCTTAAGTTTAGAACCCCAGAGAGAGAAGGCGTTTCCCAAACTGAATCAATCGACTAGATCATGTGCAATACGCAGGCGCCGCTGTATGTTGCATGAT

Full Affymetrix probeset data:

Annotations for 1628421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720