FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628423_at:

>probe:Drosophila_2:1628423_at:602:555; Interrogation_Position=4750; Antisense; GGACCCAACTTCTGCGACAACAGAG
>probe:Drosophila_2:1628423_at:655:123; Interrogation_Position=4773; Antisense; AGCGCGCAAACGGTACTCATTGATG
>probe:Drosophila_2:1628423_at:338:445; Interrogation_Position=4794; Antisense; GATGACGCATCTGATTGACCGGCAC
>probe:Drosophila_2:1628423_at:543:397; Interrogation_Position=4821; Antisense; GACAACGGAGAACTTGCGCGCCAGT
>probe:Drosophila_2:1628423_at:434:71; Interrogation_Position=4892; Antisense; AGGCTCCCGTGACCATAGTGCGCAA
>probe:Drosophila_2:1628423_at:49:359; Interrogation_Position=4913; Antisense; GCAACGAGGGTCATGCCCAACGATT
>probe:Drosophila_2:1628423_at:233:707; Interrogation_Position=4974; Antisense; TTCAGCGGTTCCAGTCGTTGGCAGC
>probe:Drosophila_2:1628423_at:43:341; Interrogation_Position=5011; Antisense; GCTATGAACCGACACACGACTGATT
>probe:Drosophila_2:1628423_at:340:57; Interrogation_Position=5066; Antisense; ATGAGGGTCCAGTCACCAAGAGCAT
>probe:Drosophila_2:1628423_at:107:613; Interrogation_Position=5096; Antisense; TGACAGCGGCGCTCATTATACGCAA
>probe:Drosophila_2:1628423_at:639:15; Interrogation_Position=5110; Antisense; ATTATACGCAACCTGGTCACCTACT
>probe:Drosophila_2:1628423_at:255:177; Interrogation_Position=5158; Antisense; AAACGCTATGAGTCACGCTTGGCCA
>probe:Drosophila_2:1628423_at:630:341; Interrogation_Position=5174; Antisense; GCTTGGCCAATGTCGCCTTTAGCAA
>probe:Drosophila_2:1628423_at:683:337; Interrogation_Position=5217; Antisense; GCTCTCCCACATCATGTACGAATTG

Paste this into a BLAST search page for me
GGACCCAACTTCTGCGACAACAGAGAGCGCGCAAACGGTACTCATTGATGGATGACGCATCTGATTGACCGGCACGACAACGGAGAACTTGCGCGCCAGTAGGCTCCCGTGACCATAGTGCGCAAGCAACGAGGGTCATGCCCAACGATTTTCAGCGGTTCCAGTCGTTGGCAGCGCTATGAACCGACACACGACTGATTATGAGGGTCCAGTCACCAAGAGCATTGACAGCGGCGCTCATTATACGCAAATTATACGCAACCTGGTCACCTACTAAACGCTATGAGTCACGCTTGGCCAGCTTGGCCAATGTCGCCTTTAGCAAGCTCTCCCACATCATGTACGAATTG

Full Affymetrix probeset data:

Annotations for 1628423_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720