Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628424_at:

>probe:Drosophila_2:1628424_at:231:303; Interrogation_Position=1056; Antisense; CCTCGTGGCAGCAGCAAAGGGCTAG
>probe:Drosophila_2:1628424_at:354:257; Interrogation_Position=1070; Antisense; CAAAGGGCTAGTGGTCCTCCAGGTG
>probe:Drosophila_2:1628424_at:175:475; Interrogation_Position=1242; Antisense; GTTACGAACAACGTGACCGCAGCGA
>probe:Drosophila_2:1628424_at:645:509; Interrogation_Position=1254; Antisense; GTGACCGCAGCGATAGAAATGATCA
>probe:Drosophila_2:1628424_at:616:605; Interrogation_Position=1273; Antisense; TGATCAGCAATGGATCAGCGGGAGT
>probe:Drosophila_2:1628424_at:608:507; Interrogation_Position=1304; Antisense; GTGCAGGGTACAGGCTGGAATCCAC
>probe:Drosophila_2:1628424_at:663:331; Interrogation_Position=1317; Antisense; GCTGGAATCCACAAGGCGGCCGTGA
>probe:Drosophila_2:1628424_at:336:583; Interrogation_Position=1435; Antisense; TGGCGGCTACCGATGATCCCTAATT
>probe:Drosophila_2:1628424_at:521:413; Interrogation_Position=1472; Antisense; GACCATAAACGACTGATCCTCTTGT
>probe:Drosophila_2:1628424_at:103:405; Interrogation_Position=1482; Antisense; GACTGATCCTCTTGTAAACTACTAA
>probe:Drosophila_2:1628424_at:650:151; Interrogation_Position=1511; Antisense; ACATGTCTTTAATCGCACGCATACC
>probe:Drosophila_2:1628424_at:642:353; Interrogation_Position=1525; Antisense; GCACGCATACCCCAGTTTAATTTAT
>probe:Drosophila_2:1628424_at:333:271; Interrogation_Position=1530; Antisense; CATACCCCAGTTTAATTTATTGCGA
>probe:Drosophila_2:1628424_at:701:279; Interrogation_Position=1607; Antisense; CTAAATATGCCATCTATTTGCCAGC

Paste this into a BLAST search page for me
CCTCGTGGCAGCAGCAAAGGGCTAGCAAAGGGCTAGTGGTCCTCCAGGTGGTTACGAACAACGTGACCGCAGCGAGTGACCGCAGCGATAGAAATGATCATGATCAGCAATGGATCAGCGGGAGTGTGCAGGGTACAGGCTGGAATCCACGCTGGAATCCACAAGGCGGCCGTGATGGCGGCTACCGATGATCCCTAATTGACCATAAACGACTGATCCTCTTGTGACTGATCCTCTTGTAAACTACTAAACATGTCTTTAATCGCACGCATACCGCACGCATACCCCAGTTTAATTTATCATACCCCAGTTTAATTTATTGCGACTAAATATGCCATCTATTTGCCAGC

Full Affymetrix probeset data:

Annotations for 1628424_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime