FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628425_at:

>probe:Drosophila_2:1628425_at:180:707; Interrogation_Position=452; Antisense; TTAATTAACCAAACCGCTTCCTGCA
>probe:Drosophila_2:1628425_at:117:719; Interrogation_Position=469; Antisense; TTCCTGCAACGGGTCGTCAGAGAAC
>probe:Drosophila_2:1628425_at:517:423; Interrogation_Position=488; Antisense; GAGAACATTGACTCTGATCCACCTA
>probe:Drosophila_2:1628425_at:167:251; Interrogation_Position=528; Antisense; CAACGTCTTCATTCCAAACTTCTTG
>probe:Drosophila_2:1628425_at:429:393; Interrogation_Position=553; Antisense; GAAATCGTTAAGTCAAAGCTCGCTG
>probe:Drosophila_2:1628425_at:52:37; Interrogation_Position=583; Antisense; ATCTAACTGCTCTGGATTGACCGAG
>probe:Drosophila_2:1628425_at:495:457; Interrogation_Position=608; Antisense; GATAGCTATACCGAATCTTCTCCAG
>probe:Drosophila_2:1628425_at:688:37; Interrogation_Position=622; Antisense; ATCTTCTCCAGCTATTCAACTTGTT
>probe:Drosophila_2:1628425_at:190:227; Interrogation_Position=701; Antisense; AAGGCAAACCCTCGCTGTGTTAAAG
>probe:Drosophila_2:1628425_at:214:439; Interrogation_Position=726; Antisense; GAGGCTATGCTGAGGAGTTCCGTAA
>probe:Drosophila_2:1628425_at:608:63; Interrogation_Position=840; Antisense; ATGGTGTTACCATTGCCCTAGTGGC
>probe:Drosophila_2:1628425_at:434:623; Interrogation_Position=853; Antisense; TGCCCTAGTGGCTTCCGATAATGGA
>probe:Drosophila_2:1628425_at:620:271; Interrogation_Position=878; Antisense; CGTAGTTTCAATATTCTTCCTCCAA
>probe:Drosophila_2:1628425_at:231:181; Interrogation_Position=986; Antisense; AAACAACTGGTCTATTGTCGCCCAT

Paste this into a BLAST search page for me
TTAATTAACCAAACCGCTTCCTGCATTCCTGCAACGGGTCGTCAGAGAACGAGAACATTGACTCTGATCCACCTACAACGTCTTCATTCCAAACTTCTTGGAAATCGTTAAGTCAAAGCTCGCTGATCTAACTGCTCTGGATTGACCGAGGATAGCTATACCGAATCTTCTCCAGATCTTCTCCAGCTATTCAACTTGTTAAGGCAAACCCTCGCTGTGTTAAAGGAGGCTATGCTGAGGAGTTCCGTAAATGGTGTTACCATTGCCCTAGTGGCTGCCCTAGTGGCTTCCGATAATGGACGTAGTTTCAATATTCTTCCTCCAAAAACAACTGGTCTATTGTCGCCCAT

Full Affymetrix probeset data:

Annotations for 1628425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720