FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628428_at:

>probe:Drosophila_2:1628428_at:568:493; Interrogation_Position=1010; Antisense; GTCAATCGAAGACCATTCTCCTAGA
>probe:Drosophila_2:1628428_at:85:61; Interrogation_Position=1036; Antisense; ATGGGCAACTTTTTCCAGGTTCAAG
>probe:Drosophila_2:1628428_at:547:473; Interrogation_Position=1054; Antisense; GTTCAAGATGATTTCCTCGACTGCT
>probe:Drosophila_2:1628428_at:183:633; Interrogation_Position=1070; Antisense; TCGACTGCTTCGGTAATCCGGAAGT
>probe:Drosophila_2:1628428_at:607:159; Interrogation_Position=1124; Antisense; ACAACAAGTGCTCGTGGCTGGCAGT
>probe:Drosophila_2:1628428_at:78:233; Interrogation_Position=1155; Antisense; AATGCAGCGAGCCAATGTCGAGCAA
>probe:Drosophila_2:1628428_at:714:47; Interrogation_Position=1266; Antisense; ATCCACCTATGCCATTTTCGAGGAG
>probe:Drosophila_2:1628428_at:417:159; Interrogation_Position=1370; Antisense; ACAAAATCTACCAACGTGACTCCTA
>probe:Drosophila_2:1628428_at:492:511; Interrogation_Position=1385; Antisense; GTGACTCCTAAATTACTCAAGCGCA
>probe:Drosophila_2:1628428_at:645:201; Interrogation_Position=1403; Antisense; AAGCGCAACGACTTTACGGATACGT
>probe:Drosophila_2:1628428_at:434:83; Interrogation_Position=1476; Antisense; AGGGCTCAGCAATTACAACCGATAT
>probe:Drosophila_2:1628428_at:135:31; Interrogation_Position=929; Antisense; ATAAGACTGCCTATTACTCCTTCTA
>probe:Drosophila_2:1628428_at:427:619; Interrogation_Position=969; Antisense; TGCTTTGCACTTGGCTGGCTATAAA
>probe:Drosophila_2:1628428_at:722:663; Interrogation_Position=990; Antisense; TAAAGACGCAGAGGCCTTCCGTCAA

Paste this into a BLAST search page for me
GTCAATCGAAGACCATTCTCCTAGAATGGGCAACTTTTTCCAGGTTCAAGGTTCAAGATGATTTCCTCGACTGCTTCGACTGCTTCGGTAATCCGGAAGTACAACAAGTGCTCGTGGCTGGCAGTAATGCAGCGAGCCAATGTCGAGCAAATCCACCTATGCCATTTTCGAGGAGACAAAATCTACCAACGTGACTCCTAGTGACTCCTAAATTACTCAAGCGCAAAGCGCAACGACTTTACGGATACGTAGGGCTCAGCAATTACAACCGATATATAAGACTGCCTATTACTCCTTCTATGCTTTGCACTTGGCTGGCTATAAATAAAGACGCAGAGGCCTTCCGTCAA

Full Affymetrix probeset data:

Annotations for 1628428_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720