FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628429_at:

>probe:Drosophila_2:1628429_at:727:457; Interrogation_Position=177; Antisense; GTTGTTAAGTTTGCCGAGCCTGGAC
>probe:Drosophila_2:1628429_at:134:589; Interrogation_Position=229; Antisense; TGGTCAAGCGGTGCACCAAGCCCGA
>probe:Drosophila_2:1628429_at:165:145; Interrogation_Position=285; Antisense; ACTGCTGTGGGCTTCTGCATCATGG
>probe:Drosophila_2:1628429_at:355:269; Interrogation_Position=314; Antisense; CATCGGCTTCTTCGTTAAGTTGATA
>probe:Drosophila_2:1628429_at:277:291; Interrogation_Position=326; Antisense; CGTTAAGTTGATACACATCCCCATC
>probe:Drosophila_2:1628429_at:314:271; Interrogation_Position=341; Antisense; CATCCCCATCAACAATATCATCGTG
>probe:Drosophila_2:1628429_at:214:271; Interrogation_Position=359; Antisense; CATCGTGGGCTCTTAAATGCGCTGA
>probe:Drosophila_2:1628429_at:603:261; Interrogation_Position=397; Antisense; CACCAATCATCCAATCATCCATTAT
>probe:Drosophila_2:1628429_at:52:343; Interrogation_Position=423; Antisense; GCATACATCAGATCAACGTCTTTTT
>probe:Drosophila_2:1628429_at:240:485; Interrogation_Position=475; Antisense; GTATGGACCATGTGCATTCAGCGAA
>probe:Drosophila_2:1628429_at:656:273; Interrogation_Position=489; Antisense; CATTCAGCGAATGCCTTTCTAACAA
>probe:Drosophila_2:1628429_at:532:239; Interrogation_Position=603; Antisense; AATCACCCGTCTTCATAGCATTTGT
>probe:Drosophila_2:1628429_at:564:623; Interrogation_Position=634; Antisense; TGCGCATCCCCGCTAATAAATGTTA
>probe:Drosophila_2:1628429_at:225:425; Interrogation_Position=700; Antisense; GAGACGCAACGTTACATTGCTTGAA

Paste this into a BLAST search page for me
GTTGTTAAGTTTGCCGAGCCTGGACTGGTCAAGCGGTGCACCAAGCCCGAACTGCTGTGGGCTTCTGCATCATGGCATCGGCTTCTTCGTTAAGTTGATACGTTAAGTTGATACACATCCCCATCCATCCCCATCAACAATATCATCGTGCATCGTGGGCTCTTAAATGCGCTGACACCAATCATCCAATCATCCATTATGCATACATCAGATCAACGTCTTTTTGTATGGACCATGTGCATTCAGCGAACATTCAGCGAATGCCTTTCTAACAAAATCACCCGTCTTCATAGCATTTGTTGCGCATCCCCGCTAATAAATGTTAGAGACGCAACGTTACATTGCTTGAA

Full Affymetrix probeset data:

Annotations for 1628429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720