FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628430_at:

>probe:Drosophila_2:1628430_at:319:527; Interrogation_Position=157; Antisense; GGGAATCACTGGTCTAGCGAAGCAC
>probe:Drosophila_2:1628430_at:443:669; Interrogation_Position=171; Antisense; TAGCGAAGCACCCAGCCACGGATGT
>probe:Drosophila_2:1628430_at:396:259; Interrogation_Position=187; Antisense; CACGGATGTGTCTGTACTTGGGAGT
>probe:Drosophila_2:1628430_at:707:441; Interrogation_Position=228; Antisense; GATGTGGTGGCCTACTGCATGTGCC
>probe:Drosophila_2:1628430_at:112:619; Interrogation_Position=243; Antisense; TGCATGTGCCGTGTCCTGGAGCTGT
>probe:Drosophila_2:1628430_at:684:617; Interrogation_Position=279; Antisense; TGCATGATGGTCTGCGGCTCCATGA
>probe:Drosophila_2:1628430_at:128:95; Interrogation_Position=30; Antisense; AGTTGGTCGCCTGTGAACACGGTGA
>probe:Drosophila_2:1628430_at:317:57; Interrogation_Position=300; Antisense; ATGAGAGCCAAGCTGACCCACGGAC
>probe:Drosophila_2:1628430_at:186:555; Interrogation_Position=321; Antisense; GGACCCACCAACGAGCTGGAGCAAT
>probe:Drosophila_2:1628430_at:560:129; Interrogation_Position=347; Antisense; ACCAGGACACCAGGAGTGCTGCTAA
>probe:Drosophila_2:1628430_at:209:621; Interrogation_Position=363; Antisense; TGCTGCTAAAAGGATGCGCGCGTTT
>probe:Drosophila_2:1628430_at:394:169; Interrogation_Position=421; Antisense; AAAGGCAACTTTTCTAGTGGCGAAT
>probe:Drosophila_2:1628430_at:361:267; Interrogation_Position=82; Antisense; CAGGATATAGGAGTGCACCCAGCTT
>probe:Drosophila_2:1628430_at:288:355; Interrogation_Position=96; Antisense; GCACCCAGCTTACACATCGATAGAT

Paste this into a BLAST search page for me
GGGAATCACTGGTCTAGCGAAGCACTAGCGAAGCACCCAGCCACGGATGTCACGGATGTGTCTGTACTTGGGAGTGATGTGGTGGCCTACTGCATGTGCCTGCATGTGCCGTGTCCTGGAGCTGTTGCATGATGGTCTGCGGCTCCATGAAGTTGGTCGCCTGTGAACACGGTGAATGAGAGCCAAGCTGACCCACGGACGGACCCACCAACGAGCTGGAGCAATACCAGGACACCAGGAGTGCTGCTAATGCTGCTAAAAGGATGCGCGCGTTTAAAGGCAACTTTTCTAGTGGCGAATCAGGATATAGGAGTGCACCCAGCTTGCACCCAGCTTACACATCGATAGAT

Full Affymetrix probeset data:

Annotations for 1628430_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720