FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628432_at:

>probe:Drosophila_2:1628432_at:323:425; Interrogation_Position=1020; Antisense; GAGACGTCAAGATTCCGCAGCTGTT
>probe:Drosophila_2:1628432_at:567:351; Interrogation_Position=1036; Antisense; GCAGCTGTTCCGGAAAATCGAATCT
>probe:Drosophila_2:1628432_at:241:105; Interrogation_Position=1086; Antisense; AGACGCAGGCTGTCTTCCAGTTCAA
>probe:Drosophila_2:1628432_at:184:343; Interrogation_Position=1131; Antisense; GCACCTGGTTCCTGGACCTGAAGAA
>probe:Drosophila_2:1628432_at:221:299; Interrogation_Position=1206; Antisense; CGCTCACCATGAACTCGAAGAACTT
>probe:Drosophila_2:1628432_at:155:191; Interrogation_Position=1226; Antisense; AACTTCTTCGACATGTTCTCGGGTA
>probe:Drosophila_2:1628432_at:112:679; Interrogation_Position=1241; Antisense; TTCTCGGGTAAACTGAAGGCGGCTC
>probe:Drosophila_2:1628432_at:594:575; Interrogation_Position=1298; Antisense; GGCGATTTCCAGAAGGCTCTCAAGC
>probe:Drosophila_2:1628432_at:461:371; Interrogation_Position=1336; Antisense; GAAGGCGCTCAAGTCCAAGCTGTAG
>probe:Drosophila_2:1628432_at:543:521; Interrogation_Position=1372; Antisense; GTGGCTGAGTTTTCTATTGTTTACA
>probe:Drosophila_2:1628432_at:556:367; Interrogation_Position=872; Antisense; GAATCGGCGGGCATCACTGATCTCA
>probe:Drosophila_2:1628432_at:445:365; Interrogation_Position=899; Antisense; GAATACGCCTGCTTCCGCGAGAACG
>probe:Drosophila_2:1628432_at:603:323; Interrogation_Position=915; Antisense; GCGAGAACGCCGACAAGCTGATGGT
>probe:Drosophila_2:1628432_at:705:119; Interrogation_Position=930; Antisense; AGCTGATGGTGGACTTCTTCGTGGA

Paste this into a BLAST search page for me
GAGACGTCAAGATTCCGCAGCTGTTGCAGCTGTTCCGGAAAATCGAATCTAGACGCAGGCTGTCTTCCAGTTCAAGCACCTGGTTCCTGGACCTGAAGAACGCTCACCATGAACTCGAAGAACTTAACTTCTTCGACATGTTCTCGGGTATTCTCGGGTAAACTGAAGGCGGCTCGGCGATTTCCAGAAGGCTCTCAAGCGAAGGCGCTCAAGTCCAAGCTGTAGGTGGCTGAGTTTTCTATTGTTTACAGAATCGGCGGGCATCACTGATCTCAGAATACGCCTGCTTCCGCGAGAACGGCGAGAACGCCGACAAGCTGATGGTAGCTGATGGTGGACTTCTTCGTGGA

Full Affymetrix probeset data:

Annotations for 1628432_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720