Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628436_at:

>probe:Drosophila_2:1628436_at:693:103; Interrogation_Position=1031; Antisense; AGACGGGCAAATCGGACAGCTATCC
>probe:Drosophila_2:1628436_at:698:75; Interrogation_Position=1079; Antisense; AGGAGTACTCGCACATGATACGCCG
>probe:Drosophila_2:1628436_at:454:605; Interrogation_Position=1094; Antisense; TGATACGCCGCGGTTCGATAGCACC
>probe:Drosophila_2:1628436_at:365:323; Interrogation_Position=1156; Antisense; GCGCCGCCAGTTTCTATTTTCCTAA
>probe:Drosophila_2:1628436_at:362:255; Interrogation_Position=1177; Antisense; CTAACCGACGTCCAGGCCAAAATGG
>probe:Drosophila_2:1628436_at:636:467; Interrogation_Position=1240; Antisense; GTTGTCACCTTATCGCCGGACGAGG
>probe:Drosophila_2:1628436_at:75:201; Interrogation_Position=1285; Antisense; AACGCGGCCAATTGCGAGGACCAAC
>probe:Drosophila_2:1628436_at:306:545; Interrogation_Position=1320; Antisense; GGATCACAACTATCCGGCGTATGTG
>probe:Drosophila_2:1628436_at:558:47; Interrogation_Position=1331; Antisense; ATCCGGCGTATGTGCGCAGTCTGAA
>probe:Drosophila_2:1628436_at:294:201; Interrogation_Position=1358; Antisense; AACGCGAGTGCTGGAAGTTGCACCA
>probe:Drosophila_2:1628436_at:327:311; Interrogation_Position=1394; Antisense; CCAAGGGCGTCAGTGTGAGCTATGA
>probe:Drosophila_2:1628436_at:565:287; Interrogation_Position=1448; Antisense; CCGAGTTCCGGCACTTTCAAAAGCA
>probe:Drosophila_2:1628436_at:333:283; Interrogation_Position=1529; Antisense; CTGCAGCCGCAATCCTTGAGAGCGG
>probe:Drosophila_2:1628436_at:640:169; Interrogation_Position=1557; Antisense; AAAGGATGGTCGCAAGCCTCCAGTC

Paste this into a BLAST search page for me
AGACGGGCAAATCGGACAGCTATCCAGGAGTACTCGCACATGATACGCCGTGATACGCCGCGGTTCGATAGCACCGCGCCGCCAGTTTCTATTTTCCTAACTAACCGACGTCCAGGCCAAAATGGGTTGTCACCTTATCGCCGGACGAGGAACGCGGCCAATTGCGAGGACCAACGGATCACAACTATCCGGCGTATGTGATCCGGCGTATGTGCGCAGTCTGAAAACGCGAGTGCTGGAAGTTGCACCACCAAGGGCGTCAGTGTGAGCTATGACCGAGTTCCGGCACTTTCAAAAGCACTGCAGCCGCAATCCTTGAGAGCGGAAAGGATGGTCGCAAGCCTCCAGTC

Full Affymetrix probeset data:

Annotations for 1628436_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime