Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628437_at:

>probe:Drosophila_2:1628437_at:325:625; Interrogation_Position=1062; Antisense; TGCCAGGTACTTTTTGTTCCAGAAA
>probe:Drosophila_2:1628437_at:512:407; Interrogation_Position=1119; Antisense; GACGTGGTCTGTAGTGACTCCTTTA
>probe:Drosophila_2:1628437_at:633:251; Interrogation_Position=1151; Antisense; CAACGATTCCTTTGTTCTGGGCTTT
>probe:Drosophila_2:1628437_at:347:491; Interrogation_Position=1190; Antisense; GTACAACATATCCTGGGCATCGCTA
>probe:Drosophila_2:1628437_at:420:271; Interrogation_Position=1207; Antisense; CATCGCTATTCTGCGTGCACAAGAA
>probe:Drosophila_2:1628437_at:214:373; Interrogation_Position=1229; Antisense; GAAGGTGATGTTCGTATTCTCCCTA
>probe:Drosophila_2:1628437_at:582:459; Interrogation_Position=1273; Antisense; GATTTCTGCTTATCTTTGCCACCAA
>probe:Drosophila_2:1628437_at:427:645; Interrogation_Position=1348; Antisense; TCATAATTGGGCTGCTCGGTGGTTC
>probe:Drosophila_2:1628437_at:405:533; Interrogation_Position=1365; Antisense; GGTGGTTCCCTATTGGTATTCGTGC
>probe:Drosophila_2:1628437_at:449:483; Interrogation_Position=1417; Antisense; GTATCAGCCTGATGTGGTGCCGATG
>probe:Drosophila_2:1628437_at:214:593; Interrogation_Position=1465; Antisense; TGGTGGGCTCCAAGATCCAGTACAA
>probe:Drosophila_2:1628437_at:373:89; Interrogation_Position=1483; Antisense; AGTACAACTGCGAACTCTTCCTGTT
>probe:Drosophila_2:1628437_at:409:451; Interrogation_Position=1511; Antisense; GATCTCCATACTACCCTTGAGTAAG
>probe:Drosophila_2:1628437_at:583:347; Interrogation_Position=952; Antisense; GCATGGTTATGTTCGTCCTAGGGCT

Paste this into a BLAST search page for me
TGCCAGGTACTTTTTGTTCCAGAAAGACGTGGTCTGTAGTGACTCCTTTACAACGATTCCTTTGTTCTGGGCTTTGTACAACATATCCTGGGCATCGCTACATCGCTATTCTGCGTGCACAAGAAGAAGGTGATGTTCGTATTCTCCCTAGATTTCTGCTTATCTTTGCCACCAATCATAATTGGGCTGCTCGGTGGTTCGGTGGTTCCCTATTGGTATTCGTGCGTATCAGCCTGATGTGGTGCCGATGTGGTGGGCTCCAAGATCCAGTACAAAGTACAACTGCGAACTCTTCCTGTTGATCTCCATACTACCCTTGAGTAAGGCATGGTTATGTTCGTCCTAGGGCT

Full Affymetrix probeset data:

Annotations for 1628437_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime