FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628438_at:

>probe:Drosophila_2:1628438_at:450:263; Interrogation_Position=3725; Antisense; CAGCTGCCAATGGATCTGTGACCAG
>probe:Drosophila_2:1628438_at:171:551; Interrogation_Position=3749; Antisense; GGAGAAGAGCTCCTTTGAACCCTCC
>probe:Drosophila_2:1628438_at:192:107; Interrogation_Position=3790; Antisense; AGACACATTTGTACATCTCAGGAAA
>probe:Drosophila_2:1628438_at:234:567; Interrogation_Position=3816; Antisense; GGCAAATTCTCGTGGCTGTCAGATA
>probe:Drosophila_2:1628438_at:446:561; Interrogation_Position=3848; Antisense; GGAAAAGCCCATTCAACCAGAACTT
>probe:Drosophila_2:1628438_at:423:385; Interrogation_Position=3867; Antisense; GAACTTAGCCTTAATCAACCACTGA
>probe:Drosophila_2:1628438_at:351:249; Interrogation_Position=3893; Antisense; CAATTTGGTCGACGTGGAGCGCATT
>probe:Drosophila_2:1628438_at:117:555; Interrogation_Position=3908; Antisense; GGAGCGCATTACAGACCAAAAGTAT
>probe:Drosophila_2:1628438_at:480:469; Interrogation_Position=3980; Antisense; GTTGCAGTTCGAAACGCATGCCAAT
>probe:Drosophila_2:1628438_at:84:51; Interrogation_Position=4003; Antisense; ATGCCGCATGTTGCCTGAATGTCAT
>probe:Drosophila_2:1628438_at:58:689; Interrogation_Position=4048; Antisense; TATTTGGAGTGCCATTCAGTCTCTC
>probe:Drosophila_2:1628438_at:96:649; Interrogation_Position=4063; Antisense; TCAGTCTCTCTGGAACGTGAGGAGC
>probe:Drosophila_2:1628438_at:23:23; Interrogation_Position=4108; Antisense; ATATAGCCTGTACCAATTATTGTGC
>probe:Drosophila_2:1628438_at:22:395; Interrogation_Position=4220; Antisense; GAAATGGTGCTGTACCACGATTTAA

Paste this into a BLAST search page for me
CAGCTGCCAATGGATCTGTGACCAGGGAGAAGAGCTCCTTTGAACCCTCCAGACACATTTGTACATCTCAGGAAAGGCAAATTCTCGTGGCTGTCAGATAGGAAAAGCCCATTCAACCAGAACTTGAACTTAGCCTTAATCAACCACTGACAATTTGGTCGACGTGGAGCGCATTGGAGCGCATTACAGACCAAAAGTATGTTGCAGTTCGAAACGCATGCCAATATGCCGCATGTTGCCTGAATGTCATTATTTGGAGTGCCATTCAGTCTCTCTCAGTCTCTCTGGAACGTGAGGAGCATATAGCCTGTACCAATTATTGTGCGAAATGGTGCTGTACCACGATTTAA

Full Affymetrix probeset data:

Annotations for 1628438_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720