FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628440_at:

>probe:Drosophila_2:1628440_at:463:1; Interrogation_Position=1690; Antisense; AATGGTAAGATATCTTTGGTAATAC
>probe:Drosophila_2:1628440_at:127:729; Interrogation_Position=1705; Antisense; TTGGTAATACAAACTGCGTCTAAAT
>probe:Drosophila_2:1628440_at:590:283; Interrogation_Position=1718; Antisense; CTGCGTCTAAATGAGTGCGGTCCTT
>probe:Drosophila_2:1628440_at:7:327; Interrogation_Position=1720; Antisense; GCGTCTAAATGAGTGCGGTCCTTAC
>probe:Drosophila_2:1628440_at:600:167; Interrogation_Position=1726; Antisense; AAATGAGTGCGGTCCTTACTTATCT
>probe:Drosophila_2:1628440_at:17:57; Interrogation_Position=1728; Antisense; ATGAGTGCGGTCCTTACTTATCTTC
>probe:Drosophila_2:1628440_at:92:87; Interrogation_Position=1731; Antisense; AGTGCGGTCCTTACTTATCTTCTGA
>probe:Drosophila_2:1628440_at:60:623; Interrogation_Position=1733; Antisense; TGCGGTCCTTACTTATCTTCTGATT
>probe:Drosophila_2:1628440_at:469:535; Interrogation_Position=1736; Antisense; GGTCCTTACTTATCTTCTGATTGCT
>probe:Drosophila_2:1628440_at:87:703; Interrogation_Position=1745; Antisense; TTATCTTCTGATTGCTAACTGTGCT
>probe:Drosophila_2:1628440_at:661:715; Interrogation_Position=1750; Antisense; TTCTGATTGCTAACTGTGCTCTCGC
>probe:Drosophila_2:1628440_at:196:465; Interrogation_Position=1754; Antisense; GATTGCTAACTGTGCTCTCGCAGAT
>probe:Drosophila_2:1628440_at:631:659; Interrogation_Position=1760; Antisense; TAACTGTGCTCTCGCAGATCTTTCA
>probe:Drosophila_2:1628440_at:531:597; Interrogation_Position=1764; Antisense; TGTGCTCTCGCAGATCTTTCAAATG

Paste this into a BLAST search page for me
AATGGTAAGATATCTTTGGTAATACTTGGTAATACAAACTGCGTCTAAATCTGCGTCTAAATGAGTGCGGTCCTTGCGTCTAAATGAGTGCGGTCCTTACAAATGAGTGCGGTCCTTACTTATCTATGAGTGCGGTCCTTACTTATCTTCAGTGCGGTCCTTACTTATCTTCTGATGCGGTCCTTACTTATCTTCTGATTGGTCCTTACTTATCTTCTGATTGCTTTATCTTCTGATTGCTAACTGTGCTTTCTGATTGCTAACTGTGCTCTCGCGATTGCTAACTGTGCTCTCGCAGATTAACTGTGCTCTCGCAGATCTTTCATGTGCTCTCGCAGATCTTTCAAATG

Full Affymetrix probeset data:

Annotations for 1628440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720