FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628445_at:

>probe:Drosophila_2:1628445_at:614:391; Interrogation_Position=1023; Antisense; GAAAGTGGTCGTCCTATTTCGCGAA
>probe:Drosophila_2:1628445_at:68:653; Interrogation_Position=1037; Antisense; TATTTCGCGAACACAACGGGTTGCC
>probe:Drosophila_2:1628445_at:634:469; Interrogation_Position=1056; Antisense; GTTGCCCAATGGAAGAGGTGATCCC
>probe:Drosophila_2:1628445_at:555:99; Interrogation_Position=1069; Antisense; AGAGGTGATCCCAGACGTTGCTCAG
>probe:Drosophila_2:1628445_at:380:729; Interrogation_Position=1154; Antisense; TTGGCCATTTTAGACGGCTGTCCAG
>probe:Drosophila_2:1628445_at:393:701; Interrogation_Position=1163; Antisense; TTAGACGGCTGTCCAGGGTCCTCAA
>probe:Drosophila_2:1628445_at:730:557; Interrogation_Position=1181; Antisense; TCCTCAAGAAGGAGCTATGAACAGC
>probe:Drosophila_2:1628445_at:105:381; Interrogation_Position=1199; Antisense; GAACAGCGTATAGAAATCTTGACCT
>probe:Drosophila_2:1628445_at:246:395; Interrogation_Position=1211; Antisense; GAAATCTTGACCTAGCTGGTATTTA
>probe:Drosophila_2:1628445_at:458:413; Interrogation_Position=1219; Antisense; GACCTAGCTGGTATTTATTAGTACA
>probe:Drosophila_2:1628445_at:724:495; Interrogation_Position=764; Antisense; GTCAGCGTCTGGACCACCAGAAACA
>probe:Drosophila_2:1628445_at:234:185; Interrogation_Position=785; Antisense; AACAATTGAAGCAACACAGTCTGAG
>probe:Drosophila_2:1628445_at:633:425; Interrogation_Position=889; Antisense; GAGATGCAGTTGCTCAGGCACCTGA
>probe:Drosophila_2:1628445_at:601:95; Interrogation_Position=968; Antisense; AGACCACCACCTCTCTTTTGGTACA

Paste this into a BLAST search page for me
GAAAGTGGTCGTCCTATTTCGCGAATATTTCGCGAACACAACGGGTTGCCGTTGCCCAATGGAAGAGGTGATCCCAGAGGTGATCCCAGACGTTGCTCAGTTGGCCATTTTAGACGGCTGTCCAGTTAGACGGCTGTCCAGGGTCCTCAATCCTCAAGAAGGAGCTATGAACAGCGAACAGCGTATAGAAATCTTGACCTGAAATCTTGACCTAGCTGGTATTTAGACCTAGCTGGTATTTATTAGTACAGTCAGCGTCTGGACCACCAGAAACAAACAATTGAAGCAACACAGTCTGAGGAGATGCAGTTGCTCAGGCACCTGAAGACCACCACCTCTCTTTTGGTACA

Full Affymetrix probeset data:

Annotations for 1628445_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720