Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628446_at:

>probe:Drosophila_2:1628446_at:306:371; Interrogation_Position=108; Antisense; GAATGGCCCCAAAGATCAGTGTTGC
>probe:Drosophila_2:1628446_at:24:579; Interrogation_Position=112; Antisense; GGCCCCAAAGATCAGTGTTGCAAGA
>probe:Drosophila_2:1628446_at:38:257; Interrogation_Position=117; Antisense; CAAAGATCAGTGTTGCAAGAGCAAG
>probe:Drosophila_2:1628446_at:611:65; Interrogation_Position=13; Antisense; ATGGTTTGCAAAGGCTGCGGAACAA
>probe:Drosophila_2:1628446_at:117:169; Interrogation_Position=22; Antisense; AAAGGCTGCGGAACAAACTGCAAGT
>probe:Drosophila_2:1628446_at:311:151; Interrogation_Position=34; Antisense; ACAAACTGCAAGTGCCAGGACACCA
>probe:Drosophila_2:1628446_at:154:361; Interrogation_Position=41; Antisense; GCAAGTGCCAGGACACCAAGTGCGG
>probe:Drosophila_2:1628446_at:39:269; Interrogation_Position=49; Antisense; CAGGACACCAAGTGCGGCGACAATT
>probe:Drosophila_2:1628446_at:350:507; Interrogation_Position=60; Antisense; GTGCGGCGACAATTGCGCCTGTAAT
>probe:Drosophila_2:1628446_at:602:395; Interrogation_Position=67; Antisense; GACAATTGCGCCTGTAATCAGGACT
>probe:Drosophila_2:1628446_at:172:9; Interrogation_Position=71; Antisense; ATTGCGCCTGTAATCAGGACTGCAA
>probe:Drosophila_2:1628446_at:626:653; Interrogation_Position=81; Antisense; TAATCAGGACTGCAAGTGCGTGTGC
>probe:Drosophila_2:1628446_at:243:507; Interrogation_Position=96; Antisense; GTGCGTGTGCAAGAATGGCCCCAAA
>probe:Drosophila_2:1628446_at:477:329; Interrogation_Position=98; Antisense; GCGTGTGCAAGAATGGCCCCAAAGA

Paste this into a BLAST search page for me
GAATGGCCCCAAAGATCAGTGTTGCGGCCCCAAAGATCAGTGTTGCAAGACAAAGATCAGTGTTGCAAGAGCAAGATGGTTTGCAAAGGCTGCGGAACAAAAAGGCTGCGGAACAAACTGCAAGTACAAACTGCAAGTGCCAGGACACCAGCAAGTGCCAGGACACCAAGTGCGGCAGGACACCAAGTGCGGCGACAATTGTGCGGCGACAATTGCGCCTGTAATGACAATTGCGCCTGTAATCAGGACTATTGCGCCTGTAATCAGGACTGCAATAATCAGGACTGCAAGTGCGTGTGCGTGCGTGTGCAAGAATGGCCCCAAAGCGTGTGCAAGAATGGCCCCAAAGA

Full Affymetrix probeset data:

Annotations for 1628446_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime