Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628447_at:

>probe:Drosophila_2:1628447_at:286:645; Interrogation_Position=418; Antisense; TCATGCAGGATATACGCCTACGCCT
>probe:Drosophila_2:1628447_at:228:671; Interrogation_Position=436; Antisense; TACGCCTGGAACCACAGCACAGTAA
>probe:Drosophila_2:1628447_at:324:89; Interrogation_Position=456; Antisense; AGTAAAGCCACATTCATATCCTCCT
>probe:Drosophila_2:1628447_at:122:639; Interrogation_Position=492; Antisense; TCGTCCTCATCCCAAACAGCTGAGA
>probe:Drosophila_2:1628447_at:199:335; Interrogation_Position=510; Antisense; GCTGAGACCACGCTGATTGAGACAG
>probe:Drosophila_2:1628447_at:716:399; Interrogation_Position=530; Antisense; GACAGCTGAGAAGTCGCCAGCCAGT
>probe:Drosophila_2:1628447_at:674:561; Interrogation_Position=567; Antisense; GGAACAGTGACAACGACATCGCCGC
>probe:Drosophila_2:1628447_at:338:119; Interrogation_Position=712; Antisense; AGCTGCATCTGCTGCATAGCCACCA
>probe:Drosophila_2:1628447_at:85:27; Interrogation_Position=727; Antisense; ATAGCCACCACGATGTCCAGGAGCT
>probe:Drosophila_2:1628447_at:42:335; Interrogation_Position=749; Antisense; GCTGTCCGGACAGGAGCATCCACAT
>probe:Drosophila_2:1628447_at:659:163; Interrogation_Position=847; Antisense; AAATGAATAATTGCCGTCGTTTGGT
>probe:Drosophila_2:1628447_at:307:499; Interrogation_Position=862; Antisense; GTCGTTTGGTGGATAAGCCGCCGCT
>probe:Drosophila_2:1628447_at:24:31; Interrogation_Position=874; Antisense; ATAAGCCGCCGCTGGTAAGTTCTGC
>probe:Drosophila_2:1628447_at:88:657; Interrogation_Position=889; Antisense; TAAGTTCTGCGAGGGTTCACTGTAA

Paste this into a BLAST search page for me
TCATGCAGGATATACGCCTACGCCTTACGCCTGGAACCACAGCACAGTAAAGTAAAGCCACATTCATATCCTCCTTCGTCCTCATCCCAAACAGCTGAGAGCTGAGACCACGCTGATTGAGACAGGACAGCTGAGAAGTCGCCAGCCAGTGGAACAGTGACAACGACATCGCCGCAGCTGCATCTGCTGCATAGCCACCAATAGCCACCACGATGTCCAGGAGCTGCTGTCCGGACAGGAGCATCCACATAAATGAATAATTGCCGTCGTTTGGTGTCGTTTGGTGGATAAGCCGCCGCTATAAGCCGCCGCTGGTAAGTTCTGCTAAGTTCTGCGAGGGTTCACTGTAA

Full Affymetrix probeset data:

Annotations for 1628447_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime