FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628448_at:

>probe:Drosophila_2:1628448_at:210:427; Interrogation_Position=419; Antisense; GAGATAAGCGCCAATCCTCACGTGT
>probe:Drosophila_2:1628448_at:581:267; Interrogation_Position=475; Antisense; CAGTGTTCGCATAGCAGGATCTGCT
>probe:Drosophila_2:1628448_at:99:453; Interrogation_Position=492; Antisense; GATCTGCTCACCAGCTAACGGAGGA
>probe:Drosophila_2:1628448_at:457:97; Interrogation_Position=558; Antisense; AGATGAGCATCACCCATGGACCACG
>probe:Drosophila_2:1628448_at:195:67; Interrogation_Position=573; Antisense; ATGGACCACGATACGCTGCGGCCGA
>probe:Drosophila_2:1628448_at:98:123; Interrogation_Position=636; Antisense; AGCGCTTGAACACCTGGCTTGGCAA
>probe:Drosophila_2:1628448_at:249:359; Interrogation_Position=657; Antisense; GCAAGCAACCGGAGGAGATCCCCAT
>probe:Drosophila_2:1628448_at:508:527; Interrogation_Position=694; Antisense; GGGAGGCTATATTCTTACACCCAGC
>probe:Drosophila_2:1628448_at:558:665; Interrogation_Position=709; Antisense; TACACCCAGCCTATACGAATTCGGA
>probe:Drosophila_2:1628448_at:517:507; Interrogation_Position=767; Antisense; GTGCGATTCCGACGGTGTCTTGAAA
>probe:Drosophila_2:1628448_at:151:215; Interrogation_Position=805; Antisense; AAGAGTTGGTCACGTTCAAGCTGAA
>probe:Drosophila_2:1628448_at:375:463; Interrogation_Position=890; Antisense; GATTCTACTCTAAATCCTTCTGTGT
>probe:Drosophila_2:1628448_at:546:3; Interrogation_Position=925; Antisense; ATTGTTTTATGACCAGCGTACCCTT
>probe:Drosophila_2:1628448_at:243:283; Interrogation_Position=941; Antisense; CGTACCCTTACAGCTAAATCCTATG

Paste this into a BLAST search page for me
GAGATAAGCGCCAATCCTCACGTGTCAGTGTTCGCATAGCAGGATCTGCTGATCTGCTCACCAGCTAACGGAGGAAGATGAGCATCACCCATGGACCACGATGGACCACGATACGCTGCGGCCGAAGCGCTTGAACACCTGGCTTGGCAAGCAAGCAACCGGAGGAGATCCCCATGGGAGGCTATATTCTTACACCCAGCTACACCCAGCCTATACGAATTCGGAGTGCGATTCCGACGGTGTCTTGAAAAAGAGTTGGTCACGTTCAAGCTGAAGATTCTACTCTAAATCCTTCTGTGTATTGTTTTATGACCAGCGTACCCTTCGTACCCTTACAGCTAAATCCTATG

Full Affymetrix probeset data:

Annotations for 1628448_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720