Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628449_at:

>probe:Drosophila_2:1628449_at:268:683; Interrogation_Position=1034; Antisense; TATCGAACTGGTTACCGCAGGACGA
>probe:Drosophila_2:1628449_at:144:557; Interrogation_Position=1053; Antisense; GGACGATATCCTGGCACACGAAAAA
>probe:Drosophila_2:1628449_at:557:83; Interrogation_Position=1077; Antisense; AGTGATTGCCTTTATAACCCATGGA
>probe:Drosophila_2:1628449_at:296:199; Interrogation_Position=1092; Antisense; AACCCATGGAGGACTTTTGAGCACA
>probe:Drosophila_2:1628449_at:512:235; Interrogation_Position=1121; Antisense; AATCGATTTACCATGGCAAGCCCGT
>probe:Drosophila_2:1628449_at:218:539; Interrogation_Position=1150; Antisense; GGTATTCCCTTCTTTGGCGATCAGT
>probe:Drosophila_2:1628449_at:138:1; Interrogation_Position=1232; Antisense; AACTAACGGCTTCACTATTCCGATC
>probe:Drosophila_2:1628449_at:120:669; Interrogation_Position=1272; Antisense; TACTAGTGATCCTAGCTTCACGGAA
>probe:Drosophila_2:1628449_at:660:423; Interrogation_Position=1336; Antisense; GAGACTCCACTGGAACGAGCTGTTT
>probe:Drosophila_2:1628449_at:146:309; Interrogation_Position=1394; Antisense; CCAAGTACCTGAGAAGTGCCTGCCA
>probe:Drosophila_2:1628449_at:160:507; Interrogation_Position=1409; Antisense; GTGCCTGCCAGGATCTGAACTTCAT
>probe:Drosophila_2:1628449_at:385:257; Interrogation_Position=1441; Antisense; CACAATCTGGATGTTCTGGCGACAT
>probe:Drosophila_2:1628449_at:137:577; Interrogation_Position=1458; Antisense; GGCGACATTCTTTTCGGTCATTGGA
>probe:Drosophila_2:1628449_at:336:465; Interrogation_Position=1481; Antisense; GATTGACCGTTATTTTCGTCTTTCT

Paste this into a BLAST search page for me
TATCGAACTGGTTACCGCAGGACGAGGACGATATCCTGGCACACGAAAAAAGTGATTGCCTTTATAACCCATGGAAACCCATGGAGGACTTTTGAGCACAAATCGATTTACCATGGCAAGCCCGTGGTATTCCCTTCTTTGGCGATCAGTAACTAACGGCTTCACTATTCCGATCTACTAGTGATCCTAGCTTCACGGAAGAGACTCCACTGGAACGAGCTGTTTCCAAGTACCTGAGAAGTGCCTGCCAGTGCCTGCCAGGATCTGAACTTCATCACAATCTGGATGTTCTGGCGACATGGCGACATTCTTTTCGGTCATTGGAGATTGACCGTTATTTTCGTCTTTCT

Full Affymetrix probeset data:

Annotations for 1628449_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime