FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628450_at:

>probe:Drosophila_2:1628450_at:574:199; Interrogation_Position=1470; Antisense; AACGCGATACAGATTTCCTTAGTAC
>probe:Drosophila_2:1628450_at:121:657; Interrogation_Position=1551; Antisense; TAATGTCACACACTACACCTGCGAA
>probe:Drosophila_2:1628450_at:15:605; Interrogation_Position=1570; Antisense; TGCGAACCTTGCGACTACTAAGTCT
>probe:Drosophila_2:1628450_at:654:657; Interrogation_Position=1588; Antisense; TAAGTCTAGCGCGTAAACCGGAGAG
>probe:Drosophila_2:1628450_at:35:203; Interrogation_Position=1603; Antisense; AACCGGAGAGCTGTAGGATCTGTAT
>probe:Drosophila_2:1628450_at:374:545; Interrogation_Position=1618; Antisense; GGATCTGTATGGCTATTGCTATAAC
>probe:Drosophila_2:1628450_at:539:209; Interrogation_Position=1709; Antisense; AAGCAAATCATATCCTCTGTATAAT
>probe:Drosophila_2:1628450_at:473:339; Interrogation_Position=1764; Antisense; GCTAGTGTGGTACCTTGCAAGAACT
>probe:Drosophila_2:1628450_at:78:699; Interrogation_Position=1808; Antisense; TTATCCTTTATTGCTAACTTACTGA
>probe:Drosophila_2:1628450_at:36:151; Interrogation_Position=1835; Antisense; ACAGTTTAGATTGTTTTCCCTGGCG
>probe:Drosophila_2:1628450_at:686:719; Interrogation_Position=1850; Antisense; TTCCCTGGCGTCTTTTATGTGTAAA
>probe:Drosophila_2:1628450_at:63:397; Interrogation_Position=1876; Antisense; GACAATAACTGTTTCCACTAGGTAA
>probe:Drosophila_2:1628450_at:29:95; Interrogation_Position=1909; Antisense; AGTTGCCATCAACGATCACTGATAT
>probe:Drosophila_2:1628450_at:705:391; Interrogation_Position=1936; Antisense; GAAAGCGTTAACAAACTGCGTCAAA

Paste this into a BLAST search page for me
AACGCGATACAGATTTCCTTAGTACTAATGTCACACACTACACCTGCGAATGCGAACCTTGCGACTACTAAGTCTTAAGTCTAGCGCGTAAACCGGAGAGAACCGGAGAGCTGTAGGATCTGTATGGATCTGTATGGCTATTGCTATAACAAGCAAATCATATCCTCTGTATAATGCTAGTGTGGTACCTTGCAAGAACTTTATCCTTTATTGCTAACTTACTGAACAGTTTAGATTGTTTTCCCTGGCGTTCCCTGGCGTCTTTTATGTGTAAAGACAATAACTGTTTCCACTAGGTAAAGTTGCCATCAACGATCACTGATATGAAAGCGTTAACAAACTGCGTCAAA

Full Affymetrix probeset data:

Annotations for 1628450_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720