FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628451_at:

>probe:Drosophila_2:1628451_at:171:217; Interrogation_Position=3188; Antisense; AAGTACGCCGGTGAATTCATCCACA
>probe:Drosophila_2:1628451_at:6:87; Interrogation_Position=3213; Antisense; AGTGCAGCAGCTTGTCAAACGCGAT
>probe:Drosophila_2:1628451_at:368:351; Interrogation_Position=3219; Antisense; GCAGCTTGTCAAACGCGATCGGCGA
>probe:Drosophila_2:1628451_at:438:531; Interrogation_Position=3249; Antisense; GGTGGAGCATCAGGACCGACCAAAA
>probe:Drosophila_2:1628451_at:492:219; Interrogation_Position=3432; Antisense; AATCAAATTGCACAGGACCGTCTAG
>probe:Drosophila_2:1628451_at:196:263; Interrogation_Position=3444; Antisense; CAGGACCGTCTAGCTAATTTAGTTA
>probe:Drosophila_2:1628451_at:435:15; Interrogation_Position=3471; Antisense; ATTATACTTTGTGTGCGCATTTTGA
>probe:Drosophila_2:1628451_at:709:689; Interrogation_Position=3535; Antisense; TATTGTATGCGTATCTTGTAAGTAG
>probe:Drosophila_2:1628451_at:698:471; Interrogation_Position=3580; Antisense; GTTCACAAGTTTATCTAGTTTCTCA
>probe:Drosophila_2:1628451_at:22:643; Interrogation_Position=3593; Antisense; TCTAGTTTCTCAATTCATTTTCCAA
>probe:Drosophila_2:1628451_at:560:271; Interrogation_Position=3608; Antisense; CATTTTCCAAAATGTGCCACCTGAT
>probe:Drosophila_2:1628451_at:408:505; Interrogation_Position=3621; Antisense; GTGCCACCTGATTTAGACGTGTTTT
>probe:Drosophila_2:1628451_at:14:33; Interrogation_Position=3711; Antisense; ATCGTTTTTAGAAGCAAGTACCGTG
>probe:Drosophila_2:1628451_at:651:487; Interrogation_Position=3728; Antisense; GTACCGTGTAATTTTGTATCATCGT

Paste this into a BLAST search page for me
AAGTACGCCGGTGAATTCATCCACAAGTGCAGCAGCTTGTCAAACGCGATGCAGCTTGTCAAACGCGATCGGCGAGGTGGAGCATCAGGACCGACCAAAAAATCAAATTGCACAGGACCGTCTAGCAGGACCGTCTAGCTAATTTAGTTAATTATACTTTGTGTGCGCATTTTGATATTGTATGCGTATCTTGTAAGTAGGTTCACAAGTTTATCTAGTTTCTCATCTAGTTTCTCAATTCATTTTCCAACATTTTCCAAAATGTGCCACCTGATGTGCCACCTGATTTAGACGTGTTTTATCGTTTTTAGAAGCAAGTACCGTGGTACCGTGTAATTTTGTATCATCGT

Full Affymetrix probeset data:

Annotations for 1628451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720