Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628453_at:

>probe:Drosophila_2:1628453_at:147:141; Interrogation_Position=1969; Antisense; ACGGCGGCCACGATACACATGTAGG
>probe:Drosophila_2:1628453_at:276:419; Interrogation_Position=2049; Antisense; GAGCTGCAGCTATACCGACGATGAA
>probe:Drosophila_2:1628453_at:284:177; Interrogation_Position=2092; Antisense; AAACGAATTCTGATCCCTGACGGAG
>probe:Drosophila_2:1628453_at:617:45; Interrogation_Position=2104; Antisense; ATCCCTGACGGAGCAGTATCGTGAA
>probe:Drosophila_2:1628453_at:720:383; Interrogation_Position=2145; Antisense; GAACTGAGAAGCAATCGCCATCAAA
>probe:Drosophila_2:1628453_at:333:153; Interrogation_Position=2185; Antisense; ACATGGACATGGATCGACCGAGCAC
>probe:Drosophila_2:1628453_at:259:413; Interrogation_Position=2200; Antisense; GACCGAGCACCGAGCATCAGGTGTA
>probe:Drosophila_2:1628453_at:508:265; Interrogation_Position=2217; Antisense; CAGGTGTAATCCTCCTATCTTTTAA
>probe:Drosophila_2:1628453_at:467:389; Interrogation_Position=2256; Antisense; GAAACCCGTCTGTAATTGTGATGTG
>probe:Drosophila_2:1628453_at:648:595; Interrogation_Position=2272; Antisense; TGTGATGTGTTCCATGATGCGTCCA
>probe:Drosophila_2:1628453_at:416:447; Interrogation_Position=2287; Antisense; GATGCGTCCACAATGTCAACCAAAA
>probe:Drosophila_2:1628453_at:114:461; Interrogation_Position=2338; Antisense; GATTTAGCTCAGAACGCTGCCGAAA
>probe:Drosophila_2:1628453_at:176:73; Interrogation_Position=2425; Antisense; AGGACCTGAGTTCTTGACTCCCAGT
>probe:Drosophila_2:1628453_at:635:487; Interrogation_Position=2541; Antisense; GTACCGCCTGCCCATTAGAAGAAAA

Paste this into a BLAST search page for me
ACGGCGGCCACGATACACATGTAGGGAGCTGCAGCTATACCGACGATGAAAAACGAATTCTGATCCCTGACGGAGATCCCTGACGGAGCAGTATCGTGAAGAACTGAGAAGCAATCGCCATCAAAACATGGACATGGATCGACCGAGCACGACCGAGCACCGAGCATCAGGTGTACAGGTGTAATCCTCCTATCTTTTAAGAAACCCGTCTGTAATTGTGATGTGTGTGATGTGTTCCATGATGCGTCCAGATGCGTCCACAATGTCAACCAAAAGATTTAGCTCAGAACGCTGCCGAAAAGGACCTGAGTTCTTGACTCCCAGTGTACCGCCTGCCCATTAGAAGAAAA

Full Affymetrix probeset data:

Annotations for 1628453_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime