Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628454_at:

>probe:Drosophila_2:1628454_at:194:99; Interrogation_Position=1184; Antisense; AGAGGGCGTCCAATCGACCTGGTTG
>probe:Drosophila_2:1628454_at:122:311; Interrogation_Position=1307; Antisense; CCAACGCGCTGGTGGAGAGCTTCAA
>probe:Drosophila_2:1628454_at:457:419; Interrogation_Position=1323; Antisense; GAGCTTCAACAAGTCCTATCTCAGC
>probe:Drosophila_2:1628454_at:698:697; Interrogation_Position=1371; Antisense; TTATTTCCGGGAGTCGGTCTACTAT
>probe:Drosophila_2:1628454_at:608:91; Interrogation_Position=1430; Antisense; AGTTCTTGTCAAACGTCGGTGGTGT
>probe:Drosophila_2:1628454_at:143:473; Interrogation_Position=1464; Antisense; GTTCATGGGCTTTAGTGTCATCTCC
>probe:Drosophila_2:1628454_at:218:581; Interrogation_Position=1490; Antisense; TGGCCGAGATCCTATACTTCTTGAT
>probe:Drosophila_2:1628454_at:422:451; Interrogation_Position=1512; Antisense; GATCTTAAAACCACTCGCTGAGCTT
>probe:Drosophila_2:1628454_at:511:145; Interrogation_Position=1524; Antisense; ACTCGCTGAGCTTTTCGTTTGGAAG
>probe:Drosophila_2:1628454_at:167:101; Interrogation_Position=1547; Antisense; AGAGGTCATCTCATGTGGACTCAGA
>probe:Drosophila_2:1628454_at:325:103; Interrogation_Position=1574; Antisense; AGAGCCTCAAACACAATGCCTTCGG
>probe:Drosophila_2:1628454_at:713:223; Interrogation_Position=1607; Antisense; AAGGACAATCTTCAGACAACCCCAG
>probe:Drosophila_2:1628454_at:114:195; Interrogation_Position=1624; Antisense; AACCCCAGTTTCTGGCACTCAAAAG
>probe:Drosophila_2:1628454_at:385:417; Interrogation_Position=1648; Antisense; GAGCTGTATCCCAAAGGTGTTTCAA

Paste this into a BLAST search page for me
AGAGGGCGTCCAATCGACCTGGTTGCCAACGCGCTGGTGGAGAGCTTCAAGAGCTTCAACAAGTCCTATCTCAGCTTATTTCCGGGAGTCGGTCTACTATAGTTCTTGTCAAACGTCGGTGGTGTGTTCATGGGCTTTAGTGTCATCTCCTGGCCGAGATCCTATACTTCTTGATGATCTTAAAACCACTCGCTGAGCTTACTCGCTGAGCTTTTCGTTTGGAAGAGAGGTCATCTCATGTGGACTCAGAAGAGCCTCAAACACAATGCCTTCGGAAGGACAATCTTCAGACAACCCCAGAACCCCAGTTTCTGGCACTCAAAAGGAGCTGTATCCCAAAGGTGTTTCAA

Full Affymetrix probeset data:

Annotations for 1628454_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime