FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628456_at:

>probe:Drosophila_2:1628456_at:281:71; Interrogation_Position=1046; Antisense; AGGCAGTCCGGCTATGATGCACGTC
>probe:Drosophila_2:1628456_at:433:445; Interrogation_Position=1061; Antisense; GATGCACGTCTGTCCGGAGGTCACA
>probe:Drosophila_2:1628456_at:366:491; Interrogation_Position=1107; Antisense; GTCAAGCCAATCAGTGTACCGGAGA
>probe:Drosophila_2:1628456_at:568:599; Interrogation_Position=1121; Antisense; TGTACCGGAGATCCACGAGGCCATG
>probe:Drosophila_2:1628456_at:151:217; Interrogation_Position=1173; Antisense; AAGATTGGGCGGTATCGCAACTCTT
>probe:Drosophila_2:1628456_at:686:357; Interrogation_Position=1189; Antisense; GCAACTCTTGCGACATCGATTTCCG
>probe:Drosophila_2:1628456_at:237:305; Interrogation_Position=1211; Antisense; CCGGCGCAGTTTTCTAGCCATTTAA
>probe:Drosophila_2:1628456_at:146:319; Interrogation_Position=637; Antisense; GGTTCCTTAGTATCCGCACGGGAAG
>probe:Drosophila_2:1628456_at:198:489; Interrogation_Position=725; Antisense; GTACGAGCTACACGACGAGGACCGA
>probe:Drosophila_2:1628456_at:145:459; Interrogation_Position=776; Antisense; GATATCGCAGATCCTTACGGGCCAG
>probe:Drosophila_2:1628456_at:317:607; Interrogation_Position=818; Antisense; TGAGGCGCGCAAGACGTCATTCTAC
>probe:Drosophila_2:1628456_at:528:453; Interrogation_Position=860; Antisense; GATCAAGAACAAGTTCCGCCGCTTT
>probe:Drosophila_2:1628456_at:370:385; Interrogation_Position=926; Antisense; GAACATTTTGGCCTATCTGGCGCAT
>probe:Drosophila_2:1628456_at:386:7; Interrogation_Position=957; Antisense; ATTGCCGCCATTGTCGACTATTCGA

Paste this into a BLAST search page for me
AGGCAGTCCGGCTATGATGCACGTCGATGCACGTCTGTCCGGAGGTCACAGTCAAGCCAATCAGTGTACCGGAGATGTACCGGAGATCCACGAGGCCATGAAGATTGGGCGGTATCGCAACTCTTGCAACTCTTGCGACATCGATTTCCGCCGGCGCAGTTTTCTAGCCATTTAAGGTTCCTTAGTATCCGCACGGGAAGGTACGAGCTACACGACGAGGACCGAGATATCGCAGATCCTTACGGGCCAGTGAGGCGCGCAAGACGTCATTCTACGATCAAGAACAAGTTCCGCCGCTTTGAACATTTTGGCCTATCTGGCGCATATTGCCGCCATTGTCGACTATTCGA

Full Affymetrix probeset data:

Annotations for 1628456_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720