FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628459_at:

>probe:Drosophila_2:1628459_at:120:333; Interrogation_Position=2270; Antisense; GCTGGCTCTAGTTCTCAGACCAAGT
>probe:Drosophila_2:1628459_at:430:651; Interrogation_Position=2323; Antisense; TCAAGGCTCACAGCAGGGTCTTCAA
>probe:Drosophila_2:1628459_at:17:81; Interrogation_Position=2337; Antisense; AGGGTCTTCAAGCTGGATCCACTGG
>probe:Drosophila_2:1628459_at:481:615; Interrogation_Position=2364; Antisense; TGCAGACTAGTTCCCTACAAGGCAC
>probe:Drosophila_2:1628459_at:430:393; Interrogation_Position=2390; Antisense; GAAAGTTCTGCATCTCAAAGCGCCG
>probe:Drosophila_2:1628459_at:155:175; Interrogation_Position=2406; Antisense; AAAGCGCCGCTCTTCAGCGATTGAA
>probe:Drosophila_2:1628459_at:552:647; Interrogation_Position=2467; Antisense; TCAGAAAACCTCTTCTTCAAGCTCG
>probe:Drosophila_2:1628459_at:697:709; Interrogation_Position=2482; Antisense; TTCAAGCTCGCACAGTAACTCACAA
>probe:Drosophila_2:1628459_at:282:101; Interrogation_Position=2514; Antisense; AGAGTTCGTCATCACAGTCATCGCA
>probe:Drosophila_2:1628459_at:293:497; Interrogation_Position=2530; Antisense; GTCATCGCAGGCATCACAGTCTGAA
>probe:Drosophila_2:1628459_at:714:235; Interrogation_Position=2601; Antisense; AATCGAGCTCCAAGACTCAGTCGGA
>probe:Drosophila_2:1628459_at:156:219; Interrogation_Position=2630; Antisense; AAGTCCGAGTCGTCGTCTCAATCAT
>probe:Drosophila_2:1628459_at:6:655; Interrogation_Position=2647; Antisense; TCAATCATCGTCACATTCATCGTCG
>probe:Drosophila_2:1628459_at:569:493; Interrogation_Position=2674; Antisense; GTCAACGTCGAACTCATCTTCAAAC

Paste this into a BLAST search page for me
GCTGGCTCTAGTTCTCAGACCAAGTTCAAGGCTCACAGCAGGGTCTTCAAAGGGTCTTCAAGCTGGATCCACTGGTGCAGACTAGTTCCCTACAAGGCACGAAAGTTCTGCATCTCAAAGCGCCGAAAGCGCCGCTCTTCAGCGATTGAATCAGAAAACCTCTTCTTCAAGCTCGTTCAAGCTCGCACAGTAACTCACAAAGAGTTCGTCATCACAGTCATCGCAGTCATCGCAGGCATCACAGTCTGAAAATCGAGCTCCAAGACTCAGTCGGAAAGTCCGAGTCGTCGTCTCAATCATTCAATCATCGTCACATTCATCGTCGGTCAACGTCGAACTCATCTTCAAAC

Full Affymetrix probeset data:

Annotations for 1628459_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720