FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628460_at:

>probe:Drosophila_2:1628460_at:585:119; Interrogation_Position=2198; Antisense; AGCTGATGTGCGGTATTCCCTGCTA
>probe:Drosophila_2:1628460_at:676:53; Interrogation_Position=2246; Antisense; ATGCACTTTGGCTTGCTCGAGAGGA
>probe:Drosophila_2:1628460_at:593:81; Interrogation_Position=2265; Antisense; AGAGGAGCCCGTGGAACTGCCTTAT
>probe:Drosophila_2:1628460_at:507:219; Interrogation_Position=2291; Antisense; CAACGGTCTTGGAGTTCCTTAGCAA
>probe:Drosophila_2:1628460_at:468:105; Interrogation_Position=2315; Antisense; AGACAGTTCTGTCCGGTGGCTATCA
>probe:Drosophila_2:1628460_at:128:81; Interrogation_Position=2339; Antisense; AGGTGCGCTATGAGTTCCGGCTAAC
>probe:Drosophila_2:1628460_at:93:25; Interrogation_Position=2375; Antisense; ATATGGGTCTGTTCTTCAAGCCACT
>probe:Drosophila_2:1628460_at:198:177; Interrogation_Position=2410; Antisense; AAACTACTCCGATGGACGTTTGCTC
>probe:Drosophila_2:1628460_at:206:481; Interrogation_Position=2427; Antisense; GTTTGCTCCCGCAATGCTGGATAAT
>probe:Drosophila_2:1628460_at:540:29; Interrogation_Position=2501; Antisense; ATAACACTCCCATCGAATTCTTCGT
>probe:Drosophila_2:1628460_at:334:583; Interrogation_Position=2544; Antisense; TGGCAACTTCAATGAACCCGTCTTT
>probe:Drosophila_2:1628460_at:522:63; Interrogation_Position=2572; Antisense; ATGGGCGTCTCTGGACACTATGTCA
>probe:Drosophila_2:1628460_at:548:51; Interrogation_Position=2615; Antisense; ATGCGTTGAGCCTGGAGTTCCTTGC
>probe:Drosophila_2:1628460_at:581:587; Interrogation_Position=2666; Antisense; TGGAGTGGCCCAGTAGCTACGAACG

Paste this into a BLAST search page for me
AGCTGATGTGCGGTATTCCCTGCTAATGCACTTTGGCTTGCTCGAGAGGAAGAGGAGCCCGTGGAACTGCCTTATCAACGGTCTTGGAGTTCCTTAGCAAAGACAGTTCTGTCCGGTGGCTATCAAGGTGCGCTATGAGTTCCGGCTAACATATGGGTCTGTTCTTCAAGCCACTAAACTACTCCGATGGACGTTTGCTCGTTTGCTCCCGCAATGCTGGATAATATAACACTCCCATCGAATTCTTCGTTGGCAACTTCAATGAACCCGTCTTTATGGGCGTCTCTGGACACTATGTCAATGCGTTGAGCCTGGAGTTCCTTGCTGGAGTGGCCCAGTAGCTACGAACG

Full Affymetrix probeset data:

Annotations for 1628460_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720