FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628463_at:

>probe:Drosophila_2:1628463_at:419:391; Interrogation_Position=436; Antisense; GAAAGCATTCACACGCTGTCGAAGA
>probe:Drosophila_2:1628463_at:356:239; Interrogation_Position=478; Antisense; AATCAAGAAGCGCTGCCGGCACGTG
>probe:Drosophila_2:1628463_at:41:373; Interrogation_Position=504; Antisense; GAAGGGTGTCACTGTACTCCGTGGC
>probe:Drosophila_2:1628463_at:558:667; Interrogation_Position=518; Antisense; TACTCCGTGGCGATAAACGCGACCA
>probe:Drosophila_2:1628463_at:554:199; Interrogation_Position=533; Antisense; AACGCGACCAGTTGATACCCTTTGA
>probe:Drosophila_2:1628463_at:498:669; Interrogation_Position=548; Antisense; TACCCTTTGATCTGAAGGCGACCGA
>probe:Drosophila_2:1628463_at:317:75; Interrogation_Position=579; Antisense; AGGACTGGACTCACTGTGTCAGCAT
>probe:Drosophila_2:1628463_at:170:143; Interrogation_Position=591; Antisense; ACTGTGTCAGCATCTCGAGAGTCTA
>probe:Drosophila_2:1628463_at:70:117; Interrogation_Position=641; Antisense; AGCTTATCTCGCTGGCCATGGACAT
>probe:Drosophila_2:1628463_at:537:369; Interrogation_Position=661; Antisense; GACATGGCTATGGAGTCACGTGCTC
>probe:Drosophila_2:1628463_at:634:667; Interrogation_Position=690; Antisense; TACTCCGCCCAAGGAAGCAGACAAT
>probe:Drosophila_2:1628463_at:98:429; Interrogation_Position=730; Antisense; GAGATTGATCTCACATCGCCGATGA
>probe:Drosophila_2:1628463_at:722:255; Interrogation_Position=757; Antisense; CACACCTGACTTCCGATTAACTGAT
>probe:Drosophila_2:1628463_at:345:371; Interrogation_Position=798; Antisense; GAAGACCCTTTTCCAATGGAGCACT

Paste this into a BLAST search page for me
GAAAGCATTCACACGCTGTCGAAGAAATCAAGAAGCGCTGCCGGCACGTGGAAGGGTGTCACTGTACTCCGTGGCTACTCCGTGGCGATAAACGCGACCAAACGCGACCAGTTGATACCCTTTGATACCCTTTGATCTGAAGGCGACCGAAGGACTGGACTCACTGTGTCAGCATACTGTGTCAGCATCTCGAGAGTCTAAGCTTATCTCGCTGGCCATGGACATGACATGGCTATGGAGTCACGTGCTCTACTCCGCCCAAGGAAGCAGACAATGAGATTGATCTCACATCGCCGATGACACACCTGACTTCCGATTAACTGATGAAGACCCTTTTCCAATGGAGCACT

Full Affymetrix probeset data:

Annotations for 1628463_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720