Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628465_a_at:

>probe:Drosophila_2:1628465_a_at:430:445; Interrogation_Position=1163; Antisense; GATGCAGAGCAGTTACTAACCCCTG
>probe:Drosophila_2:1628465_a_at:453:21; Interrogation_Position=1216; Antisense; ATATAAGATACGTCCCGATGCCGTC
>probe:Drosophila_2:1628465_a_at:591:447; Interrogation_Position=1232; Antisense; GATGCCGTCGCTCACATTGATGAAC
>probe:Drosophila_2:1628465_a_at:581:9; Interrogation_Position=1277; Antisense; ATTCTATGTACGTACGTGTAACGAG
>probe:Drosophila_2:1628465_a_at:119:391; Interrogation_Position=1305; Antisense; GAAACATTTACTAACCGATGCCAAA
>probe:Drosophila_2:1628465_a_at:410:13; Interrogation_Position=781; Antisense; ATTATATACACATCCCCTTTGGCAT
>probe:Drosophila_2:1628465_a_at:77:45; Interrogation_Position=792; Antisense; ATCCCCTTTGGCATTTTGTGTTTAG
>probe:Drosophila_2:1628465_a_at:542:601; Interrogation_Position=810; Antisense; TGTTTAGACACACCCCATGAATCCA
>probe:Drosophila_2:1628465_a_at:672:367; Interrogation_Position=828; Antisense; GAATCCAGCATAAACCATTTGAATC
>probe:Drosophila_2:1628465_a_at:161:645; Interrogation_Position=861; Antisense; TCTATAATAATCCTACGCCTATGTG
>probe:Drosophila_2:1628465_a_at:405:563; Interrogation_Position=885; Antisense; GGAAGCCACTCAAGAATCCGTCATC
>probe:Drosophila_2:1628465_a_at:549:233; Interrogation_Position=899; Antisense; AATCCGTCATCCTGCGAATATCTAT
>probe:Drosophila_2:1628465_a_at:174:123; Interrogation_Position=970; Antisense; AGCGCAAATGGCTCGTCGAACGTGA
>probe:Drosophila_2:1628465_a_at:356:613; Interrogation_Position=992; Antisense; TGAACAGCCGACTCTTTGTACGTTT

Paste this into a BLAST search page for me
GATGCAGAGCAGTTACTAACCCCTGATATAAGATACGTCCCGATGCCGTCGATGCCGTCGCTCACATTGATGAACATTCTATGTACGTACGTGTAACGAGGAAACATTTACTAACCGATGCCAAAATTATATACACATCCCCTTTGGCATATCCCCTTTGGCATTTTGTGTTTAGTGTTTAGACACACCCCATGAATCCAGAATCCAGCATAAACCATTTGAATCTCTATAATAATCCTACGCCTATGTGGGAAGCCACTCAAGAATCCGTCATCAATCCGTCATCCTGCGAATATCTATAGCGCAAATGGCTCGTCGAACGTGATGAACAGCCGACTCTTTGTACGTTT

Full Affymetrix probeset data:

Annotations for 1628465_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime