FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628467_at:

>probe:Drosophila_2:1628467_at:240:441; Interrogation_Position=121; Antisense; GATGGCTGTCAGTTACTCGCGAATC
>probe:Drosophila_2:1628467_at:653:365; Interrogation_Position=141; Antisense; GAATCGCAATCAAGTGCCCCTTATG
>probe:Drosophila_2:1628467_at:298:595; Interrogation_Position=170; Antisense; TGGGCCGGAATATCATGGAGCGTTT
>probe:Drosophila_2:1628467_at:404:9; Interrogation_Position=18; Antisense; ATTCGTACTCGAACAACCTGTTGCC
>probe:Drosophila_2:1628467_at:182:553; Interrogation_Position=186; Antisense; GGAGCGTTTCAGCAACTTTCCCAAA
>probe:Drosophila_2:1628467_at:560:187; Interrogation_Position=209; Antisense; AACAGTGTCCTTTCAAGCCAAACTT
>probe:Drosophila_2:1628467_at:593:17; Interrogation_Position=252; Antisense; ATTTCGCCTGGACCTGAACCTTGTG
>probe:Drosophila_2:1628467_at:654:727; Interrogation_Position=272; Antisense; TTGTGCCCGCCGTGGACATGGAGAC
>probe:Drosophila_2:1628467_at:649:551; Interrogation_Position=291; Antisense; GGAGACGCCAGTTCAAATCGAGTTC
>probe:Drosophila_2:1628467_at:615:461; Interrogation_Position=348; Antisense; GATTACCGGTTATCTGATGGCACGT
>probe:Drosophila_2:1628467_at:232:535; Interrogation_Position=398; Antisense; GGTCCAACCCTAATGAAAGTGCCTT
>probe:Drosophila_2:1628467_at:86:645; Interrogation_Position=53; Antisense; TCTTCATAAAAATCGTCCTGCCGCG
>probe:Drosophila_2:1628467_at:2:349; Interrogation_Position=77; Antisense; GCAGGAGACCTCTACCGGATTTCGT
>probe:Drosophila_2:1628467_at:625:543; Interrogation_Position=93; Antisense; GGATTTCGTCCTGCTCAATGTGACC

Paste this into a BLAST search page for me
GATGGCTGTCAGTTACTCGCGAATCGAATCGCAATCAAGTGCCCCTTATGTGGGCCGGAATATCATGGAGCGTTTATTCGTACTCGAACAACCTGTTGCCGGAGCGTTTCAGCAACTTTCCCAAAAACAGTGTCCTTTCAAGCCAAACTTATTTCGCCTGGACCTGAACCTTGTGTTGTGCCCGCCGTGGACATGGAGACGGAGACGCCAGTTCAAATCGAGTTCGATTACCGGTTATCTGATGGCACGTGGTCCAACCCTAATGAAAGTGCCTTTCTTCATAAAAATCGTCCTGCCGCGGCAGGAGACCTCTACCGGATTTCGTGGATTTCGTCCTGCTCAATGTGACC

Full Affymetrix probeset data:

Annotations for 1628467_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720