Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628468_at:

>probe:Drosophila_2:1628468_at:117:423; Interrogation_Position=1052; Antisense; GAGAACTTCAACAACCTGACCCTAT
>probe:Drosophila_2:1628468_at:274:251; Interrogation_Position=1078; Antisense; CAATGACATTGCTCTGGTGGTGCTG
>probe:Drosophila_2:1628468_at:651:133; Interrogation_Position=1160; Antisense; ACGCCCCAAATGGAGGCTGAGTTGC
>probe:Drosophila_2:1628468_at:328:623; Interrogation_Position=1182; Antisense; TGCGGAGTGCAAGCTGCTTGGCCAC
>probe:Drosophila_2:1628468_at:578:175; Interrogation_Position=1246; Antisense; AAACCTGCTAAAGCGCATCGAGCTG
>probe:Drosophila_2:1628468_at:181:533; Interrogation_Position=1276; Antisense; GGTGGACCACGAGTCCTGCCAACGG
>probe:Drosophila_2:1628468_at:121:311; Interrogation_Position=1293; Antisense; GCCAACGGCTGTTGCGGCACACTGT
>probe:Drosophila_2:1628468_at:300:117; Interrogation_Position=1346; Antisense; AGCTTCACTTGTGCCGGCGGCGTAA
>probe:Drosophila_2:1628468_at:661:601; Interrogation_Position=1410; Antisense; TGTTTTGCACTTTGCCTGGGCAGAA
>probe:Drosophila_2:1628468_at:163:265; Interrogation_Position=1430; Antisense; CAGAAGGATCGCTACCAGCTGGTGG
>probe:Drosophila_2:1628468_at:657:109; Interrogation_Position=1485; Antisense; AGAAGGATGTGCCTGCGGCCTACAC
>probe:Drosophila_2:1628468_at:324:77; Interrogation_Position=1545; Antisense; AGGTGACGAAGAGCGGGTTCCCATT
>probe:Drosophila_2:1628468_at:247:433; Interrogation_Position=1574; Antisense; GAGGGCTTTTAGGTTACGCACACAG
>probe:Drosophila_2:1628468_at:374:77; Interrogation_Position=1584; Antisense; AGGTTACGCACACAGCTAGCTTGTA

Paste this into a BLAST search page for me
GAGAACTTCAACAACCTGACCCTATCAATGACATTGCTCTGGTGGTGCTGACGCCCCAAATGGAGGCTGAGTTGCTGCGGAGTGCAAGCTGCTTGGCCACAAACCTGCTAAAGCGCATCGAGCTGGGTGGACCACGAGTCCTGCCAACGGGCCAACGGCTGTTGCGGCACACTGTAGCTTCACTTGTGCCGGCGGCGTAATGTTTTGCACTTTGCCTGGGCAGAACAGAAGGATCGCTACCAGCTGGTGGAGAAGGATGTGCCTGCGGCCTACACAGGTGACGAAGAGCGGGTTCCCATTGAGGGCTTTTAGGTTACGCACACAGAGGTTACGCACACAGCTAGCTTGTA

Full Affymetrix probeset data:

Annotations for 1628468_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime