Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628472_at:

>probe:Drosophila_2:1628472_at:576:355; Interrogation_Position=1587; Antisense; GCACATTCCAATAATCGATGCCGCC
>probe:Drosophila_2:1628472_at:481:297; Interrogation_Position=1607; Antisense; CCGCCAACAAGTCCGGTTCTATGGA
>probe:Drosophila_2:1628472_at:460:713; Interrogation_Position=1623; Antisense; TTCTATGGAGTTCAGCTGCAGTGCC
>probe:Drosophila_2:1628472_at:504:721; Interrogation_Position=1672; Antisense; TTGCAGGTGTCCTTCGTCTCGAAAA
>probe:Drosophila_2:1628472_at:675:331; Interrogation_Position=1747; Antisense; GCGGCGGTCAAGTATTCAAGCGAGT
>probe:Drosophila_2:1628472_at:555:205; Interrogation_Position=1764; Antisense; AAGCGAGTCCATTCTGTTCGTGGAA
>probe:Drosophila_2:1628472_at:708:89; Interrogation_Position=1790; Antisense; AGTACGAGATCGTGTAGGCCGCGCC
>probe:Drosophila_2:1628472_at:220:531; Interrogation_Position=1862; Antisense; GGGTCATCCGATGCGATGCAATTAA
>probe:Drosophila_2:1628472_at:622:421; Interrogation_Position=1907; Antisense; GAGAATTATTTTTCCATGTGCGAAC
>probe:Drosophila_2:1628472_at:594:695; Interrogation_Position=1940; Antisense; TTTATGGCGCAGACAGCTTCTCAGA
>probe:Drosophila_2:1628472_at:559:177; Interrogation_Position=2019; Antisense; AAACTAATTTTGTGCACTCCGCTGC
>probe:Drosophila_2:1628472_at:239:299; Interrogation_Position=2038; Antisense; CGCTGCGCTGCATATAACGGTATCA
>probe:Drosophila_2:1628472_at:143:701; Interrogation_Position=2104; Antisense; TTTTGTTTTGTGTGCTTCGTCGCAC
>probe:Drosophila_2:1628472_at:678:501; Interrogation_Position=2122; Antisense; GTCGCACCCCTTCGATTTGAGTAAT

Paste this into a BLAST search page for me
GCACATTCCAATAATCGATGCCGCCCCGCCAACAAGTCCGGTTCTATGGATTCTATGGAGTTCAGCTGCAGTGCCTTGCAGGTGTCCTTCGTCTCGAAAAGCGGCGGTCAAGTATTCAAGCGAGTAAGCGAGTCCATTCTGTTCGTGGAAAGTACGAGATCGTGTAGGCCGCGCCGGGTCATCCGATGCGATGCAATTAAGAGAATTATTTTTCCATGTGCGAACTTTATGGCGCAGACAGCTTCTCAGAAAACTAATTTTGTGCACTCCGCTGCCGCTGCGCTGCATATAACGGTATCATTTTGTTTTGTGTGCTTCGTCGCACGTCGCACCCCTTCGATTTGAGTAAT

Full Affymetrix probeset data:

Annotations for 1628472_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime