Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628473_at:

>probe:Drosophila_2:1628473_at:483:303; Interrogation_Position=346; Antisense; CCGCAATGGTCGCAGCAGTAGAAAC
>probe:Drosophila_2:1628473_at:689:225; Interrogation_Position=350; Antisense; AATGGTCGCAGCAGTAGAAACCGCA
>probe:Drosophila_2:1628473_at:215:503; Interrogation_Position=354; Antisense; GTCGCAGCAGTAGAAACCGCAGATC
>probe:Drosophila_2:1628473_at:34:353; Interrogation_Position=357; Antisense; GCAGCAGTAGAAACCGCAGATCGGA
>probe:Drosophila_2:1628473_at:274:483; Interrogation_Position=363; Antisense; GTAGAAACCGCAGATCGGAAGAATA
>probe:Drosophila_2:1628473_at:109:377; Interrogation_Position=380; Antisense; GAAGAATAAGAGATCCAGGACCAAT
>probe:Drosophila_2:1628473_at:123:415; Interrogation_Position=398; Antisense; GACCAATAGAAAATCCACGCCACTC
>probe:Drosophila_2:1628473_at:123:25; Interrogation_Position=403; Antisense; ATAGAAAATCCACGCCACTCTCAAT
>probe:Drosophila_2:1628473_at:4:235; Interrogation_Position=409; Antisense; AATCCACGCCACTCTCAATGCTGAA
>probe:Drosophila_2:1628473_at:659:641; Interrogation_Position=421; Antisense; TCTCAATGCTGAACCCCAGGAACCA
>probe:Drosophila_2:1628473_at:380:333; Interrogation_Position=428; Antisense; GCTGAACCCCAGGAACCAATTGTTT
>probe:Drosophila_2:1628473_at:383:699; Interrogation_Position=461; Antisense; TTTTATTTCTTAGTCCATAAGCTTA
>probe:Drosophila_2:1628473_at:293:499; Interrogation_Position=473; Antisense; GTCCATAAGCTTAACTAACACTACA
>probe:Drosophila_2:1628473_at:678:175; Interrogation_Position=489; Antisense; AACACTACAATAATTCTTTTACAAG

Paste this into a BLAST search page for me
CCGCAATGGTCGCAGCAGTAGAAACAATGGTCGCAGCAGTAGAAACCGCAGTCGCAGCAGTAGAAACCGCAGATCGCAGCAGTAGAAACCGCAGATCGGAGTAGAAACCGCAGATCGGAAGAATAGAAGAATAAGAGATCCAGGACCAATGACCAATAGAAAATCCACGCCACTCATAGAAAATCCACGCCACTCTCAATAATCCACGCCACTCTCAATGCTGAATCTCAATGCTGAACCCCAGGAACCAGCTGAACCCCAGGAACCAATTGTTTTTTTATTTCTTAGTCCATAAGCTTAGTCCATAAGCTTAACTAACACTACAAACACTACAATAATTCTTTTACAAG

Full Affymetrix probeset data:

Annotations for 1628473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime