FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628474_at:

>probe:Drosophila_2:1628474_at:726:459; Interrogation_Position=13; Antisense; GATTTCCATTAGTCGTTCCACGGAA
>probe:Drosophila_2:1628474_at:173:225; Interrogation_Position=136; Antisense; AAGGATCCTATCTGTGGACTGCCCG
>probe:Drosophila_2:1628474_at:661:405; Interrogation_Position=152; Antisense; GACTGCCCGCTGGTATTGATGGCAA
>probe:Drosophila_2:1628474_at:20:251; Interrogation_Position=174; Antisense; CAATGGTCTCATCAAGTGTGCCGCT
>probe:Drosophila_2:1628474_at:210:653; Interrogation_Position=185; Antisense; TCAAGTGTGCCGCTTTTATACCCAG
>probe:Drosophila_2:1628474_at:430:703; Interrogation_Position=200; Antisense; TTATACCCAGCTTCAGTTATCATCC
>probe:Drosophila_2:1628474_at:544:475; Interrogation_Position=215; Antisense; GTTATCATCCCGAAACCAATTCGTG
>probe:Drosophila_2:1628474_at:727:513; Interrogation_Position=237; Antisense; GTGTGAAAAGTTCATCTACGGCGGA
>probe:Drosophila_2:1628474_at:432:637; Interrogation_Position=25; Antisense; TCGTTCCACGGAAGCTGGGAGATAT
>probe:Drosophila_2:1628474_at:107:575; Interrogation_Position=265; Antisense; GGCGGCAATGAGAACCGATTTGGAA
>probe:Drosophila_2:1628474_at:321:459; Interrogation_Position=281; Antisense; GATTTGGAACCCAGGAGCTCTGCGA
>probe:Drosophila_2:1628474_at:130:29; Interrogation_Position=321; Antisense; ATAAATTTGACCTCTATGCTCTACA
>probe:Drosophila_2:1628474_at:725:681; Interrogation_Position=75; Antisense; TATGAAATTCATTGCTGCCGTCTGT
>probe:Drosophila_2:1628474_at:214:499; Interrogation_Position=94; Antisense; GTCTGTTTGATGTTCGCCCTGGTGG

Paste this into a BLAST search page for me
GATTTCCATTAGTCGTTCCACGGAAAAGGATCCTATCTGTGGACTGCCCGGACTGCCCGCTGGTATTGATGGCAACAATGGTCTCATCAAGTGTGCCGCTTCAAGTGTGCCGCTTTTATACCCAGTTATACCCAGCTTCAGTTATCATCCGTTATCATCCCGAAACCAATTCGTGGTGTGAAAAGTTCATCTACGGCGGATCGTTCCACGGAAGCTGGGAGATATGGCGGCAATGAGAACCGATTTGGAAGATTTGGAACCCAGGAGCTCTGCGAATAAATTTGACCTCTATGCTCTACATATGAAATTCATTGCTGCCGTCTGTGTCTGTTTGATGTTCGCCCTGGTGG

Full Affymetrix probeset data:

Annotations for 1628474_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720