FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628475_at:

>probe:Drosophila_2:1628475_at:360:353; Interrogation_Position=1476; Antisense; GCAGCCTTCGCTTACGATGCTAAAG
>probe:Drosophila_2:1628475_at:18:509; Interrogation_Position=1505; Antisense; GTGCGGCTAGTGTGCTCATCGAGAA
>probe:Drosophila_2:1628475_at:371:47; Interrogation_Position=1529; Antisense; ATCCGGATCCGATGCAAGACAACAG
>probe:Drosophila_2:1628475_at:677:339; Interrogation_Position=1553; Antisense; GCTATGCAAGCATCCTGAAAGGTGA
>probe:Drosophila_2:1628475_at:36:81; Interrogation_Position=1572; Antisense; AGGTGACCAGGCAGATGCAATGTCT
>probe:Drosophila_2:1628475_at:605:499; Interrogation_Position=1593; Antisense; GTCTGATTCTGCCAAGTTTCGCAAG
>probe:Drosophila_2:1628475_at:179:295; Interrogation_Position=1612; Antisense; CGCAAGCTTTGCGATGCCATCGACA
>probe:Drosophila_2:1628475_at:325:397; Interrogation_Position=1633; Antisense; GACACTCCAACAAAGCTCTACGATG
>probe:Drosophila_2:1628475_at:111:445; Interrogation_Position=1654; Antisense; GATGAGCGACAATTTCCTCCAGTGG
>probe:Drosophila_2:1628475_at:589:711; Interrogation_Position=1667; Antisense; TTCCTCCAGTGGCAATTACCGCTAA
>probe:Drosophila_2:1628475_at:348:243; Interrogation_Position=1680; Antisense; AATTACCGCTAAGGATTGACTACGT
>probe:Drosophila_2:1628475_at:699:459; Interrogation_Position=1765; Antisense; GTTAATTCACCTTAGCCAAGACGCC
>probe:Drosophila_2:1628475_at:223:251; Interrogation_Position=1781; Antisense; CAAGACGCCCCAAACAATCGTTATT
>probe:Drosophila_2:1628475_at:552:567; Interrogation_Position=1989; Antisense; GGCACTAAATCAAACTCTGTATCCT

Paste this into a BLAST search page for me
GCAGCCTTCGCTTACGATGCTAAAGGTGCGGCTAGTGTGCTCATCGAGAAATCCGGATCCGATGCAAGACAACAGGCTATGCAAGCATCCTGAAAGGTGAAGGTGACCAGGCAGATGCAATGTCTGTCTGATTCTGCCAAGTTTCGCAAGCGCAAGCTTTGCGATGCCATCGACAGACACTCCAACAAAGCTCTACGATGGATGAGCGACAATTTCCTCCAGTGGTTCCTCCAGTGGCAATTACCGCTAAAATTACCGCTAAGGATTGACTACGTGTTAATTCACCTTAGCCAAGACGCCCAAGACGCCCCAAACAATCGTTATTGGCACTAAATCAAACTCTGTATCCT

Full Affymetrix probeset data:

Annotations for 1628475_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720