Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628476_at:

>probe:Drosophila_2:1628476_at:376:415; Interrogation_Position=3077; Antisense; GAGCCCCGAGAGATTCGTGGCGAAC
>probe:Drosophila_2:1628476_at:366:463; Interrogation_Position=3088; Antisense; GATTCGTGGCGAACGGAACAAGGAC
>probe:Drosophila_2:1628476_at:663:619; Interrogation_Position=3091; Antisense; TCGTGGCGAACGGAACAAGGACAAG
>probe:Drosophila_2:1628476_at:326:335; Interrogation_Position=3118; Antisense; GCTGCTGCGCCGGAAATCGGACCTG
>probe:Drosophila_2:1628476_at:71:561; Interrogation_Position=3129; Antisense; GGAAATCGGACCTGCCATCGGACAG
>probe:Drosophila_2:1628476_at:91:641; Interrogation_Position=3134; Antisense; TCGGACCTGCCATCGGACAGTGGAA
>probe:Drosophila_2:1628476_at:227:127; Interrogation_Position=3138; Antisense; ACCTGCCATCGGACAGTGGAACCGT
>probe:Drosophila_2:1628476_at:168:397; Interrogation_Position=3149; Antisense; GACAGTGGAACCGTGAAGGCGCTAA
>probe:Drosophila_2:1628476_at:702:125; Interrogation_Position=3158; Antisense; ACCGTGAAGGCGCTAAACGAGCACA
>probe:Drosophila_2:1628476_at:419:309; Interrogation_Position=3169; Antisense; GCTAAACGAGCACAAGCGGACGGAT
>probe:Drosophila_2:1628476_at:85:253; Interrogation_Position=3181; Antisense; CAAGCGGACGGATGAGTACCTCACA
>probe:Drosophila_2:1628476_at:680:407; Interrogation_Position=3187; Antisense; GACGGATGAGTACCTCACAACGCCG
>probe:Drosophila_2:1628476_at:343:547; Interrogation_Position=3190; Antisense; GGATGAGTACCTCACAACGCCGCCG
>probe:Drosophila_2:1628476_at:322:319; Interrogation_Position=3208; Antisense; GCCGCCGCCGGATGGAAACTACTAG

Paste this into a BLAST search page for me
GAGCCCCGAGAGATTCGTGGCGAACGATTCGTGGCGAACGGAACAAGGACTCGTGGCGAACGGAACAAGGACAAGGCTGCTGCGCCGGAAATCGGACCTGGGAAATCGGACCTGCCATCGGACAGTCGGACCTGCCATCGGACAGTGGAAACCTGCCATCGGACAGTGGAACCGTGACAGTGGAACCGTGAAGGCGCTAAACCGTGAAGGCGCTAAACGAGCACAGCTAAACGAGCACAAGCGGACGGATCAAGCGGACGGATGAGTACCTCACAGACGGATGAGTACCTCACAACGCCGGGATGAGTACCTCACAACGCCGCCGGCCGCCGCCGGATGGAAACTACTAG

Full Affymetrix probeset data:

Annotations for 1628476_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime