Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628478_at:

>probe:Drosophila_2:1628478_at:429:555; Interrogation_Position=5055; Antisense; GGCACCTTGGACTCGTGAAGAGGAC
>probe:Drosophila_2:1628478_at:523:567; Interrogation_Position=5109; Antisense; GGCACGGGATCGAGAGCAGCTCATT
>probe:Drosophila_2:1628478_at:451:101; Interrogation_Position=5121; Antisense; AGAGCAGCTCATTCGGCGTATGCGC
>probe:Drosophila_2:1628478_at:69:329; Interrogation_Position=5136; Antisense; GCGTATGCGCGCCAAGCTAAAGAAT
>probe:Drosophila_2:1628478_at:25:193; Interrogation_Position=5174; Antisense; AACTACGTAGTAGGCATCAGTTTCT
>probe:Drosophila_2:1628478_at:717:569; Interrogation_Position=5186; Antisense; GGCATCAGTTTCTTATGGACTTTCT
>probe:Drosophila_2:1628478_at:414:557; Interrogation_Position=5202; Antisense; GGACTTTCTGTCCAAATTGCAGGGA
>probe:Drosophila_2:1628478_at:567:509; Interrogation_Position=5229; Antisense; GTGAGGTTTCTCTAAGATGGTCTTT
>probe:Drosophila_2:1628478_at:72:565; Interrogation_Position=5348; Antisense; GGAATTCTTTGTTGTACTGATTACC
>probe:Drosophila_2:1628478_at:367:705; Interrogation_Position=5391; Antisense; TTCCCTTCAGAATACTTAGTTTTAT
>probe:Drosophila_2:1628478_at:319:239; Interrogation_Position=5439; Antisense; AATCTACTGTACGTTGAAATTGACT
>probe:Drosophila_2:1628478_at:676:653; Interrogation_Position=5492; Antisense; TAATATTTTTGTGTCCGTCTAAGTT
>probe:Drosophila_2:1628478_at:272:369; Interrogation_Position=5535; Antisense; GAAGGTCGCATTGTTTGAATTTGAT
>probe:Drosophila_2:1628478_at:256:475; Interrogation_Position=5580; Antisense; GTTAACGAGCACATTGTTTTCCATT

Paste this into a BLAST search page for me
GGCACCTTGGACTCGTGAAGAGGACGGCACGGGATCGAGAGCAGCTCATTAGAGCAGCTCATTCGGCGTATGCGCGCGTATGCGCGCCAAGCTAAAGAATAACTACGTAGTAGGCATCAGTTTCTGGCATCAGTTTCTTATGGACTTTCTGGACTTTCTGTCCAAATTGCAGGGAGTGAGGTTTCTCTAAGATGGTCTTTGGAATTCTTTGTTGTACTGATTACCTTCCCTTCAGAATACTTAGTTTTATAATCTACTGTACGTTGAAATTGACTTAATATTTTTGTGTCCGTCTAAGTTGAAGGTCGCATTGTTTGAATTTGATGTTAACGAGCACATTGTTTTCCATT

Full Affymetrix probeset data:

Annotations for 1628478_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime