FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628479_at:

>probe:Drosophila_2:1628479_at:718:615; Interrogation_Position=1041; Antisense; TGCAGCAGCGGTTCCCGGAGAAGTT
>probe:Drosophila_2:1628479_at:691:9; Interrogation_Position=1073; Antisense; ATCTTCGACGAACGGTACAGGGCCT
>probe:Drosophila_2:1628479_at:484:639; Interrogation_Position=1113; Antisense; TCGTGGAGCGCTGGACGCGATTCTC
>probe:Drosophila_2:1628479_at:553:327; Interrogation_Position=1129; Antisense; GCGATTCTCCATTTGATGCGGTACT
>probe:Drosophila_2:1628479_at:32:441; Interrogation_Position=1143; Antisense; GATGCGGTACTTTTTATTTCATAGA
>probe:Drosophila_2:1628479_at:203:585; Interrogation_Position=1243; Antisense; TGGAATTTCATCATGCTTGCAGACT
>probe:Drosophila_2:1628479_at:340:105; Interrogation_Position=1263; Antisense; AGACTGATCTGCTCTTGGCATCTTA
>probe:Drosophila_2:1628479_at:261:725; Interrogation_Position=1277; Antisense; TTGGCATCTTAGCTTCTCGTCCAAA
>probe:Drosophila_2:1628479_at:337:419; Interrogation_Position=737; Antisense; GAGCTCATCGGCATGGTACCGCGCT
>probe:Drosophila_2:1628479_at:495:671; Interrogation_Position=753; Antisense; TACCGCGCTTCACGATGTACAAGTG
>probe:Drosophila_2:1628479_at:74:379; Interrogation_Position=803; Antisense; GAACCCGAGGACATGGAACCCGAGG
>probe:Drosophila_2:1628479_at:368:381; Interrogation_Position=818; Antisense; GAACCCGAGGAACTCATGTGCATGA
>probe:Drosophila_2:1628479_at:318:63; Interrogation_Position=833; Antisense; ATGTGCATGACCTGCATTCCGCCGT
>probe:Drosophila_2:1628479_at:382:221; Interrogation_Position=941; Antisense; AAGTGGAACGCCTTGCAGGCGCAGT

Paste this into a BLAST search page for me
TGCAGCAGCGGTTCCCGGAGAAGTTATCTTCGACGAACGGTACAGGGCCTTCGTGGAGCGCTGGACGCGATTCTCGCGATTCTCCATTTGATGCGGTACTGATGCGGTACTTTTTATTTCATAGATGGAATTTCATCATGCTTGCAGACTAGACTGATCTGCTCTTGGCATCTTATTGGCATCTTAGCTTCTCGTCCAAAGAGCTCATCGGCATGGTACCGCGCTTACCGCGCTTCACGATGTACAAGTGGAACCCGAGGACATGGAACCCGAGGGAACCCGAGGAACTCATGTGCATGAATGTGCATGACCTGCATTCCGCCGTAAGTGGAACGCCTTGCAGGCGCAGT

Full Affymetrix probeset data:

Annotations for 1628479_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720