FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628481_at:

>probe:Drosophila_2:1628481_at:691:385; Interrogation_Position=1024; Antisense; GAAAATCGATCCCTTTGTCTACGTT
>probe:Drosophila_2:1628481_at:104:377; Interrogation_Position=1099; Antisense; GAAGCAGACAGAGCCGGCGGAACCC
>probe:Drosophila_2:1628481_at:113:377; Interrogation_Position=1127; Antisense; GAAGCAGTTGCCTCCAATTAGTTAA
>probe:Drosophila_2:1628481_at:625:13; Interrogation_Position=641; Antisense; ATTAAGGATATTACCAGCGGCGAGC
>probe:Drosophila_2:1628481_at:248:47; Interrogation_Position=699; Antisense; ATCCGAATATACTGGCCGAGCTGGT
>probe:Drosophila_2:1628481_at:113:579; Interrogation_Position=734; Antisense; GGCCTGATGAAACGCAAGTTCCCAA
>probe:Drosophila_2:1628481_at:295:253; Interrogation_Position=784; Antisense; CAACCTGGCCGAGATGATCGTCAAA
>probe:Drosophila_2:1628481_at:373:493; Interrogation_Position=803; Antisense; GTCAAATTCTCCAGCGGCATTAGTT
>probe:Drosophila_2:1628481_at:75:429; Interrogation_Position=845; Antisense; GAGTACCAGCAAAACTTTGGCCTGA
>probe:Drosophila_2:1628481_at:399:385; Interrogation_Position=919; Antisense; GAACATCAAGTTCCTACTGCAGGAT
>probe:Drosophila_2:1628481_at:30:709; Interrogation_Position=945; Antisense; TTAACACTATGAGGCCCAAGCGCGA
>probe:Drosophila_2:1628481_at:472:205; Interrogation_Position=962; Antisense; AAGCGCGAGGGACGTTTCATTACAC
>probe:Drosophila_2:1628481_at:423:13; Interrogation_Position=980; Antisense; ATTACACGTGTCCTGCTGAAGAGCC
>probe:Drosophila_2:1628481_at:290:615; Interrogation_Position=996; Antisense; TGAAGAGCCCGCCAAGCAGTGAGCA

Paste this into a BLAST search page for me
GAAAATCGATCCCTTTGTCTACGTTGAAGCAGACAGAGCCGGCGGAACCCGAAGCAGTTGCCTCCAATTAGTTAAATTAAGGATATTACCAGCGGCGAGCATCCGAATATACTGGCCGAGCTGGTGGCCTGATGAAACGCAAGTTCCCAACAACCTGGCCGAGATGATCGTCAAAGTCAAATTCTCCAGCGGCATTAGTTGAGTACCAGCAAAACTTTGGCCTGAGAACATCAAGTTCCTACTGCAGGATTTAACACTATGAGGCCCAAGCGCGAAAGCGCGAGGGACGTTTCATTACACATTACACGTGTCCTGCTGAAGAGCCTGAAGAGCCCGCCAAGCAGTGAGCA

Full Affymetrix probeset data:

Annotations for 1628481_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720