Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628482_at:

>probe:Drosophila_2:1628482_at:558:459; Interrogation_Position=1021; Antisense; GATTTGTATCGTATGACCCACCAGT
>probe:Drosophila_2:1628482_at:177:509; Interrogation_Position=570; Antisense; GTGCTGCTGGTCTACGACATATCGA
>probe:Drosophila_2:1628482_at:253:117; Interrogation_Position=603; Antisense; AGCTTCGAGCACATACCGCTGTGGA
>probe:Drosophila_2:1628482_at:149:445; Interrogation_Position=626; Antisense; GATGATGGAGGCACAGCGTCACATT
>probe:Drosophila_2:1628482_at:617:475; Interrogation_Position=666; Antisense; GTTTTCGCATTGGTCGGCTGCAAAC
>probe:Drosophila_2:1628482_at:325:255; Interrogation_Position=686; Antisense; CAAACTGGACCTCATCAATGCGGGC
>probe:Drosophila_2:1628482_at:421:187; Interrogation_Position=754; Antisense; AACAGCACGGTCTGCATTTCGTTGA
>probe:Drosophila_2:1628482_at:51:273; Interrogation_Position=768; Antisense; CATTTCGTTGAGACATCGGCCCGGT
>probe:Drosophila_2:1628482_at:376:549; Interrogation_Position=806; Antisense; GGAGGAGGCATTTCGCATGGTCACC
>probe:Drosophila_2:1628482_at:154:65; Interrogation_Position=881; Antisense; ATGGGACGGCATCAAGTCTGGCTTT
>probe:Drosophila_2:1628482_at:336:719; Interrogation_Position=905; Antisense; TTCGCGACCCAATAGTCTGGACTTT
>probe:Drosophila_2:1628482_at:53:239; Interrogation_Position=930; Antisense; AATCTCGTCGTAGCAGAGCCGGAAA
>probe:Drosophila_2:1628482_at:407:497; Interrogation_Position=956; Antisense; GTCATCATGTTGTTGATTCACCCCG
>probe:Drosophila_2:1628482_at:324:133; Interrogation_Position=975; Antisense; ACCCCGACCTCATTGTCTATTATTT

Paste this into a BLAST search page for me
GATTTGTATCGTATGACCCACCAGTGTGCTGCTGGTCTACGACATATCGAAGCTTCGAGCACATACCGCTGTGGAGATGATGGAGGCACAGCGTCACATTGTTTTCGCATTGGTCGGCTGCAAACCAAACTGGACCTCATCAATGCGGGCAACAGCACGGTCTGCATTTCGTTGACATTTCGTTGAGACATCGGCCCGGTGGAGGAGGCATTTCGCATGGTCACCATGGGACGGCATCAAGTCTGGCTTTTTCGCGACCCAATAGTCTGGACTTTAATCTCGTCGTAGCAGAGCCGGAAAGTCATCATGTTGTTGATTCACCCCGACCCCGACCTCATTGTCTATTATTT

Full Affymetrix probeset data:

Annotations for 1628482_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime