FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628485_at:

>probe:Drosophila_2:1628485_at:99:185; Interrogation_Position=108; Antisense; AAAATGTCCCATGAACCGCAGAAGC
>probe:Drosophila_2:1628485_at:62:109; Interrogation_Position=127; Antisense; AGAAGCCCGCCAAGTCAGCAGTGAA
>probe:Drosophila_2:1628485_at:576:493; Interrogation_Position=140; Antisense; GTCAGCAGTGAAGGAGCCTCCGGTT
>probe:Drosophila_2:1628485_at:463:437; Interrogation_Position=171; Antisense; GAGGAGACCAGAACCACGGACAAGT
>probe:Drosophila_2:1628485_at:419:87; Interrogation_Position=193; Antisense; AGTGCCTGGCGGACTTTTGCTTGAA
>probe:Drosophila_2:1628485_at:355:373; Interrogation_Position=223; Antisense; GAAGTGGCCTGATCATCGGCAGCGC
>probe:Drosophila_2:1628485_at:403:175; Interrogation_Position=274; Antisense; AAACCTATCCCATTTGGCTGGGACT
>probe:Drosophila_2:1628485_at:365:269; Interrogation_Position=333; Antisense; CAGGCCCGCTGGAATCAACAGTAGT
>probe:Drosophila_2:1628485_at:359:83; Interrogation_Position=355; Antisense; AGTGTTCGAAAGATCTCTGAGCTTC
>probe:Drosophila_2:1628485_at:428:1; Interrogation_Position=376; Antisense; CTTCGATTAAATGTGGGCTTCCTCT
>probe:Drosophila_2:1628485_at:39:569; Interrogation_Position=391; Antisense; GGCTTCCTCTCGATAAACGTTCTAG
>probe:Drosophila_2:1628485_at:551:713; Interrogation_Position=410; Antisense; TTCTAGATACAACAGGGCTTCCGCT
>probe:Drosophila_2:1628485_at:378:81; Interrogation_Position=423; Antisense; AGGGCTTCCGCTTTTGTAATCATTT
>probe:Drosophila_2:1628485_at:441:493; Interrogation_Position=46; Antisense; GTCAATTTCCCACACAACTTAACTT

Paste this into a BLAST search page for me
AAAATGTCCCATGAACCGCAGAAGCAGAAGCCCGCCAAGTCAGCAGTGAAGTCAGCAGTGAAGGAGCCTCCGGTTGAGGAGACCAGAACCACGGACAAGTAGTGCCTGGCGGACTTTTGCTTGAAGAAGTGGCCTGATCATCGGCAGCGCAAACCTATCCCATTTGGCTGGGACTCAGGCCCGCTGGAATCAACAGTAGTAGTGTTCGAAAGATCTCTGAGCTTCCTTCGATTAAATGTGGGCTTCCTCTGGCTTCCTCTCGATAAACGTTCTAGTTCTAGATACAACAGGGCTTCCGCTAGGGCTTCCGCTTTTGTAATCATTTGTCAATTTCCCACACAACTTAACTT

Full Affymetrix probeset data:

Annotations for 1628485_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720