FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628490_at:

>probe:Drosophila_2:1628490_at:637:571; Interrogation_Position=360; Antisense; GGCTACAAGCTCAGCAAGGCTCTGA
>probe:Drosophila_2:1628490_at:234:283; Interrogation_Position=381; Antisense; CTGATCCTGCAGAAGTCCATCGAAT
>probe:Drosophila_2:1628490_at:202:29; Interrogation_Position=404; Antisense; ATACATTGGCTACCTTAACCAGCAG
>probe:Drosophila_2:1628490_at:366:35; Interrogation_Position=520; Antisense; ATCAGCAGGCGAATCCAGGGCCGGA
>probe:Drosophila_2:1628490_at:598:75; Interrogation_Position=544; Antisense; AGGAGGCACGACTCACCGATGAGGC
>probe:Drosophila_2:1628490_at:35:217; Interrogation_Position=570; Antisense; AAGTTTCAAGTGTTCCAGGCCATTA
>probe:Drosophila_2:1628490_at:129:425; Interrogation_Position=609; Antisense; GAGACATTTCAACACATACCCATGG
>probe:Drosophila_2:1628490_at:512:695; Interrogation_Position=639; Antisense; TTTAAGCAGCTGACCACCGGCATTA
>probe:Drosophila_2:1628490_at:119:667; Interrogation_Position=709; Antisense; TACTCAGTCGTACCTTGCAGCAAAT
>probe:Drosophila_2:1628490_at:675:189; Interrogation_Position=754; Antisense; AACAGGAACTTCAGGCCATGGAGCA
>probe:Drosophila_2:1628490_at:699:81; Interrogation_Position=790; Antisense; AGGGTTTCAGCTGATCGCGCGGTTA
>probe:Drosophila_2:1628490_at:411:299; Interrogation_Position=805; Antisense; CGCGCGGTTAGTTCATATTCTCATT
>probe:Drosophila_2:1628490_at:621:233; Interrogation_Position=842; Antisense; AATCCCTGTTTGGTAGATACTTTCG
>probe:Drosophila_2:1628490_at:630:455; Interrogation_Position=857; Antisense; GATACTTTCGTTACGTTTACTGCGT

Paste this into a BLAST search page for me
GGCTACAAGCTCAGCAAGGCTCTGACTGATCCTGCAGAAGTCCATCGAATATACATTGGCTACCTTAACCAGCAGATCAGCAGGCGAATCCAGGGCCGGAAGGAGGCACGACTCACCGATGAGGCAAGTTTCAAGTGTTCCAGGCCATTAGAGACATTTCAACACATACCCATGGTTTAAGCAGCTGACCACCGGCATTATACTCAGTCGTACCTTGCAGCAAATAACAGGAACTTCAGGCCATGGAGCAAGGGTTTCAGCTGATCGCGCGGTTACGCGCGGTTAGTTCATATTCTCATTAATCCCTGTTTGGTAGATACTTTCGGATACTTTCGTTACGTTTACTGCGT

Full Affymetrix probeset data:

Annotations for 1628490_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720