FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628492_at:

>probe:Drosophila_2:1628492_at:29:281; Interrogation_Position=224; Antisense; CTCACCGATCCGAAGGCATGTGTGT
>probe:Drosophila_2:1628492_at:415:63; Interrogation_Position=241; Antisense; ATGTGTGTACTTGCGCGATTTGCTT
>probe:Drosophila_2:1628492_at:648:19; Interrogation_Position=258; Antisense; ATTTGCTTGTTGATCACATCCGGGA
>probe:Drosophila_2:1628492_at:200:171; Interrogation_Position=282; Antisense; AAAGTGCTCCCGAGGCGGAGGTCAT
>probe:Drosophila_2:1628492_at:321:287; Interrogation_Position=365; Antisense; CTGGGATGTGCTCCGATTCGCAAGA
>probe:Drosophila_2:1628492_at:119:291; Interrogation_Position=439; Antisense; CGGTATTGACACCTTTGAGCTGCAA
>probe:Drosophila_2:1628492_at:625:609; Interrogation_Position=454; Antisense; TGAGCTGCAAAAATCCGCCATCAAG
>probe:Drosophila_2:1628492_at:198:33; Interrogation_Position=473; Antisense; ATCAAGCCCGGCCAAAAAGTCGTTG
>probe:Drosophila_2:1628492_at:371:171; Interrogation_Position=488; Antisense; AAAGTCGTTGTCGTTGACGATCTAC
>probe:Drosophila_2:1628492_at:532:409; Interrogation_Position=503; Antisense; GACGATCTACTAGCCACAGGTGGTT
>probe:Drosophila_2:1628492_at:174:103; Interrogation_Position=579; Antisense; AGAGCCTGGTGGTCATGGAACTAGT
>probe:Drosophila_2:1628492_at:72:221; Interrogation_Position=636; Antisense; AAGTGCATTCCCTCATTAAGTACTG
>probe:Drosophila_2:1628492_at:457:363; Interrogation_Position=671; Antisense; GAATTGTGACGAAGCCTTCCACACT
>probe:Drosophila_2:1628492_at:140:311; Interrogation_Position=689; Antisense; CCACACTTGCATTTACCTATTCAAC

Paste this into a BLAST search page for me
CTCACCGATCCGAAGGCATGTGTGTATGTGTGTACTTGCGCGATTTGCTTATTTGCTTGTTGATCACATCCGGGAAAAGTGCTCCCGAGGCGGAGGTCATCTGGGATGTGCTCCGATTCGCAAGACGGTATTGACACCTTTGAGCTGCAATGAGCTGCAAAAATCCGCCATCAAGATCAAGCCCGGCCAAAAAGTCGTTGAAAGTCGTTGTCGTTGACGATCTACGACGATCTACTAGCCACAGGTGGTTAGAGCCTGGTGGTCATGGAACTAGTAAGTGCATTCCCTCATTAAGTACTGGAATTGTGACGAAGCCTTCCACACTCCACACTTGCATTTACCTATTCAAC

Full Affymetrix probeset data:

Annotations for 1628492_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720