Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628493_at:

>probe:Drosophila_2:1628493_at:417:25; Interrogation_Position=1400; Antisense; ATAGGCGACGGCATCATCACACTAG
>probe:Drosophila_2:1628493_at:277:641; Interrogation_Position=1429; Antisense; TCTATGAGCTCGGAACGGGCCACAA
>probe:Drosophila_2:1628493_at:470:415; Interrogation_Position=1459; Antisense; GAGCCAGTTGCCCTCAATGAAGTTT
>probe:Drosophila_2:1628493_at:278:465; Interrogation_Position=1560; Antisense; GATTGTGCAGATTCTGGGCTTCCAG
>probe:Drosophila_2:1628493_at:176:595; Interrogation_Position=1574; Antisense; TGGGCTTCCAGCCACACAAGGAGAA
>probe:Drosophila_2:1628493_at:507:371; Interrogation_Position=1596; Antisense; GAAGGTCTATGAACTGTGTCCCCAG
>probe:Drosophila_2:1628493_at:152:517; Interrogation_Position=1611; Antisense; GTGTCCCCAGGAGACGAACTGCGAG
>probe:Drosophila_2:1628493_at:590:127; Interrogation_Position=1702; Antisense; ACCACGTATGTGCTGAGGATTCCCC
>probe:Drosophila_2:1628493_at:43:247; Interrogation_Position=1738; Antisense; AATTCCGTGTTGGACGACTCCAGAA
>probe:Drosophila_2:1628493_at:266:265; Interrogation_Position=1758; Antisense; CAGAAATGTCTTTACCTTCACCACG
>probe:Drosophila_2:1628493_at:625:693; Interrogation_Position=1797; Antisense; TTTCCGCAAGAGATTTCCCAAGCTG
>probe:Drosophila_2:1628493_at:583:95; Interrogation_Position=1823; Antisense; AGATCAAGTGCAGCGACTAGCCTTC
>probe:Drosophila_2:1628493_at:386:147; Interrogation_Position=1838; Antisense; ACTAGCCTTCTCTGTATGGGCTCAA
>probe:Drosophila_2:1628493_at:725:193; Interrogation_Position=1861; Antisense; AACGCACTGCTGACCATGAGATTAC

Paste this into a BLAST search page for me
ATAGGCGACGGCATCATCACACTAGTCTATGAGCTCGGAACGGGCCACAAGAGCCAGTTGCCCTCAATGAAGTTTGATTGTGCAGATTCTGGGCTTCCAGTGGGCTTCCAGCCACACAAGGAGAAGAAGGTCTATGAACTGTGTCCCCAGGTGTCCCCAGGAGACGAACTGCGAGACCACGTATGTGCTGAGGATTCCCCAATTCCGTGTTGGACGACTCCAGAACAGAAATGTCTTTACCTTCACCACGTTTCCGCAAGAGATTTCCCAAGCTGAGATCAAGTGCAGCGACTAGCCTTCACTAGCCTTCTCTGTATGGGCTCAAAACGCACTGCTGACCATGAGATTAC

Full Affymetrix probeset data:

Annotations for 1628493_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime