FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628495_at:

>probe:Drosophila_2:1628495_at:593:497; Interrogation_Position=1294; Antisense; GTCTTCAGTCAGTATGATCCGCAGA
>probe:Drosophila_2:1628495_at:508:409; Interrogation_Position=1375; Antisense; GACGAACGTGGCTATTTCCGGCAAT
>probe:Drosophila_2:1628495_at:112:565; Interrogation_Position=1394; Antisense; GGCAATTTGGGTTCGGCATCTGTGC
>probe:Drosophila_2:1628495_at:179:347; Interrogation_Position=1409; Antisense; GCATCTGTGCCATCTACAAGTCGGA
>probe:Drosophila_2:1628495_at:226:715; Interrogation_Position=1459; Antisense; TTCGATAAGGACATCACCGGCTGGG
>probe:Drosophila_2:1628495_at:516:7; Interrogation_Position=1500; Antisense; ATTCCTGGAGAAGATCGTGCGCGTA
>probe:Drosophila_2:1628495_at:169:67; Interrogation_Position=1570; Antisense; ATGGACTACAACGAGGCCGCTGAGC
>probe:Drosophila_2:1628495_at:541:521; Interrogation_Position=1596; Antisense; GTGGCGCAGATTGAGTGTCTTCCGT
>probe:Drosophila_2:1628495_at:448:199; Interrogation_Position=1632; Antisense; AACGCTGGTCCACATTTACCATGAC
>probe:Drosophila_2:1628495_at:28:707; Interrogation_Position=1647; Antisense; TTACCATGACATCAGCTGCGACGTG
>probe:Drosophila_2:1628495_at:724:545; Interrogation_Position=1677; Antisense; GGATGCGCCGCAGTACAACATGTGC
>probe:Drosophila_2:1628495_at:377:355; Interrogation_Position=1730; Antisense; GCACGCGGCTAATGGAGCAGCTCTT
>probe:Drosophila_2:1628495_at:427:263; Interrogation_Position=1758; Antisense; CAGCAGTCCCGAAAATGTCCAGTTT
>probe:Drosophila_2:1628495_at:649:183; Interrogation_Position=1769; Antisense; AAAATGTCCAGTTTGCCGCCGATTT

Paste this into a BLAST search page for me
GTCTTCAGTCAGTATGATCCGCAGAGACGAACGTGGCTATTTCCGGCAATGGCAATTTGGGTTCGGCATCTGTGCGCATCTGTGCCATCTACAAGTCGGATTCGATAAGGACATCACCGGCTGGGATTCCTGGAGAAGATCGTGCGCGTAATGGACTACAACGAGGCCGCTGAGCGTGGCGCAGATTGAGTGTCTTCCGTAACGCTGGTCCACATTTACCATGACTTACCATGACATCAGCTGCGACGTGGGATGCGCCGCAGTACAACATGTGCGCACGCGGCTAATGGAGCAGCTCTTCAGCAGTCCCGAAAATGTCCAGTTTAAAATGTCCAGTTTGCCGCCGATTT

Full Affymetrix probeset data:

Annotations for 1628495_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720