FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628496_at:

>probe:Drosophila_2:1628496_at:531:655; Interrogation_Position=2478; Antisense; TAATCTTTCTTTTGGTGGCCCTGAA
>probe:Drosophila_2:1628496_at:604:579; Interrogation_Position=2493; Antisense; TGGCCCTGAACAAGACATGATTACT
>probe:Drosophila_2:1628496_at:492:59; Interrogation_Position=2509; Antisense; ATGATTACTCCTTGGAGTCCTGGGA
>probe:Drosophila_2:1628496_at:313:529; Interrogation_Position=2522; Antisense; GGAGTCCTGGGAGAAGTCCCACCAT
>probe:Drosophila_2:1628496_at:148:219; Interrogation_Position=2535; Antisense; AAGTCCCACCATGAGGAGCGCTGGA
>probe:Drosophila_2:1628496_at:483:553; Interrogation_Position=2549; Antisense; GGAGCGCTGGAATTATCATATGGTC
>probe:Drosophila_2:1628496_at:238:645; Interrogation_Position=2564; Antisense; TCATATGGTCGGGTGTTTTGTCTAA
>probe:Drosophila_2:1628496_at:444:659; Interrogation_Position=2599; Antisense; TAACCTCTAGGTAAAATGCACTCAA
>probe:Drosophila_2:1628496_at:569:53; Interrogation_Position=2614; Antisense; ATGCACTCAAGCGATTACATTGTTT
>probe:Drosophila_2:1628496_at:6:479; Interrogation_Position=2635; Antisense; GTTTATTCTGCTGATACTTCTTTAA
>probe:Drosophila_2:1628496_at:599:217; Interrogation_Position=2658; Antisense; AAGTCAGAGCCGAACTTTCCGGCAA
>probe:Drosophila_2:1628496_at:412:161; Interrogation_Position=2718; Antisense; ACAATGTTTCCTTTACTCTAGTAAT
>probe:Drosophila_2:1628496_at:722:555; Interrogation_Position=2771; Antisense; GGAACTAATTCTGACAACCGGTTAT
>probe:Drosophila_2:1628496_at:145:397; Interrogation_Position=2901; Antisense; GAAATTCTGTTCGTCATTTGAAATT

Paste this into a BLAST search page for me
TAATCTTTCTTTTGGTGGCCCTGAATGGCCCTGAACAAGACATGATTACTATGATTACTCCTTGGAGTCCTGGGAGGAGTCCTGGGAGAAGTCCCACCATAAGTCCCACCATGAGGAGCGCTGGAGGAGCGCTGGAATTATCATATGGTCTCATATGGTCGGGTGTTTTGTCTAATAACCTCTAGGTAAAATGCACTCAAATGCACTCAAGCGATTACATTGTTTGTTTATTCTGCTGATACTTCTTTAAAAGTCAGAGCCGAACTTTCCGGCAAACAATGTTTCCTTTACTCTAGTAATGGAACTAATTCTGACAACCGGTTATGAAATTCTGTTCGTCATTTGAAATT

Full Affymetrix probeset data:

Annotations for 1628496_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720